Quick Order

Rat EGFR/HER1 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat EGFR cDNA Clone Product Information
NCBI RefSeq:HM801041.1
RefSeq ORF Size:3630bp
cDNA Description:Full length Clone DNA of Rattus norvegicus epidermal growth factor receptor with C terminal Myc tag.
Gene Synonym:Errp, ERBB1, ErbB-1, Egfr
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

As a member of the epidermal growth factor receptor (EGFR) family, EGFR protein is type I transmembrane glycoprotein that binds a subset of EGF family ligands including EGF, amphiregulin, TGF-α, betacellulin, etc. EGFR protein plays a crucial role in signaling pathway in the regulation of cell proliferation, survival and differentiation. Binding of a ligand induces EGFR protein homo- or heterodimerization, the subsequent tyrosine autophosphorylation and initiates various down stream pathways (MAPK, PI3K/PKB and STAT). In addition, EGFR signaling also has been shown to exert action on carcinogenesis and disease progression, and thus EGFR protein is proposed as a target for cancer therapy currently.

References
  • Schlessinger, J. (2000) Cell signaling by receptor tyrosine kinases. Cell 103(2): 211-25.
  • Giaccone, G. (2005) HER1/EGFR-targeted agents: predicting the future for patients with unpredictable outcomes to therapy. Ann. Oncol. 16(4): 538-48.
  • Yarden, Y., et al. (2001) Untangling the ErbB signalling network. Nat. Rev. Mol. Cell. Biol. 2(2): 127-37.
  • Size / Price
    Catalog: RG80100-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"