Ephrin B3 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80112-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin B3 Reagents
CRO Services
Product recommended

All Ephrin B3 Reagents
Ephrin B3 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1023 bp
Description
Full length Clone DNA of Rat ephrin B3 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin B3 Background Information

Ephrin B3 belongs to the ephrin family. Ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. Ephrin B3 is important in brain development as well as in its maintenance. It is especially important for forebrain function since its expression levels were particularly high in several forebrain subregions compared to other brain subregions. Ephrin B3 binds to, and induce the collapse of, commissural axons/growth cones in vitro. It may play a role in constraining the orientation of longitudinally projecting axons.

Full Name
ephrin-B3
References
  • Takemoto M, et al. (2002) Ephrin-B3-EphA4 interactions regulate the growth of specific thalamocortical axon populations in vitro. Eur J Neurosci. 16(6):1168-72.
  • Brckner K, et al. (1999) EphrinB ligands recruit GRIP family PDZ adaptor proteins into raft membrane microdomains. Neuron. 22(3):511-24.
  • Bergemann A, et al. (1998) Ephrin-B3, a ligand for the receptor EphB3, expressed at the midline of the developing neural tube. Oncogene. 16(4):471-80.
  • Ephrin B3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin B3 cDNA ORF Clone in Cloning Vector, Rat RG80112-G
    Ephrin B3 cDNA ORF Clone, Rat, untagged RG80112-UT
    Ephrin B3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80112-ACG
    Ephrin B3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80112-ACGLN
    Ephrin B3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80112-ACR
    Ephrin B3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80112-CF
    Ephrin B3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80112-NF
    Ephrin B3 cDNA ORF Clone, Rat, C-His tag RG80112-CH
    Ephrin B3 cDNA ORF Clone, Rat, N-His tag RG80112-NH
    Ephrin B3 cDNA ORF Clone, Rat, C-HA tag RG80112-CY
    Ephrin B3 cDNA ORF Clone, Rat, N-HA tag RG80112-NY
    Ephrin B3 cDNA ORF Clone, Rat, N-Myc tag RG80112-NM
    Ephrin B3 qPCR Primer Pairs, Rat RP300107

    Ephrin B3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Ephrin B3 cDNA ORF Clone in Cloning Vector, Mouse MG51147-G
    Ephrin B3 cDNA ORF Clone, Mouse, untagged MG51147-UT
    Ephrin B3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51147-ACG
    Ephrin B3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51147-ACGLN
    Ephrin B3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51147-ACR
    Ephrin B3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51147-CF
    Ephrin B3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51147-NF
    Ephrin B3 cDNA ORF Clone, Mouse, C-His tag MG51147-CH
    Ephrin B3 cDNA ORF Clone, Mouse, N-His tag MG51147-NH
    Ephrin B3 cDNA ORF Clone, Mouse, C-HA tag MG51147-CY
    Ephrin B3 cDNA ORF Clone, Mouse, N-HA tag MG51147-NY
    Ephrin B3 cDNA ORF Clone, Mouse, C-Myc tag MG51147-CM
    Ephrin B3 cDNA ORF Clone, Mouse, N-Myc tag MG51147-NM

    Ephrin B3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin B3 cDNA ORF Clone, Human, untagged HG20190-UT
    info info
    添加购物车成功! 添加购物车失败!