Ephrin-A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80115-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Ephrin-A1 Reagents
CRO Services
Product recommended

All Ephrin-A1 Reagents
Ephrin-A1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
618 bp
Description
Full length Clone DNA of Rat ephrin A1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Ephrin-A1 Background Information

EPH-related receptor tyrosine kinase ligand 1 (abbreviated as Ephrin-A1) also known as ligand of eph-related kinase 1 or EFNA1, is a member of the ephrin (EPH) family. The Eph family receptor interacting proteins (ephrins) are a family of proteins that serve as the ligands of the Eph receptor, which compose the largest known subfamily of receptor protein-tyrosine kinases (RTKs). Ephrin-A1/EFNA1 and its Eph family of receptor tyrosine kinases are expressed by cells of the SVZ. Ephrin subclasses are further distinguished by their mode of attachment to the plasma membrane: ephrin-A ligands bind EphA receptors and are anchored to the plasma membrane via a glycosylphosphatidylinositol (GPI) linkage, whereas ephrin-B ligands bind EphB receptors and are anchored via a transmembrane domain. An exception is the EphA4 receptor, which binds both subclasses of ephrins. Ephrin-A1 and one of its receptor EphA2 were expressed in xenograft endothelial cells and also tumor cells and play a role in human cancers, at least in part by influencing tumor neovascularization.

Full Name
ephrin-A1
References
  • Deroanne C, et al. (2003) EphrinA1 inactivates integrin-mediated vascular smooth muscle cell spreading via the Rac/PAK pathway. J Cell Sci. 116(7): 1367-76.
  • Ojima T, et al. (2006) EphrinA1 inhibits vascular endothelial growth factor-induced intracellular signaling and suppresses retinal neovascularization and blood-retinal barrier breakdown. Am J Pathol. 168(1): 331-9.
  • Wu D, et al. (2004) Prognostic value of EphA2 and EphrinA-1 in squamous cell cervical carcinoma. Gynecol Oncol. 94(2): 312-9.
  • Ephrin-A1 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Ephrin-A1 cDNA ORF Clone in Cloning Vector, Rat RG80115-G
    Ephrin-A1 cDNA ORF Clone, Rat, untagged RG80115-UT
    Ephrin-A1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80115-ACG
    Ephrin-A1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80115-ACGLN
    Ephrin-A1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80115-ACR
    Ephrin-A1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80115-NF
    Ephrin-A1 cDNA ORF Clone, Rat, C-His tag RG80115-CH
    Ephrin-A1 cDNA ORF Clone, Rat, N-His tag RG80115-NH
    Ephrin-A1 cDNA ORF Clone, Rat, C-HA tag RG80115-CY
    Ephrin-A1 cDNA ORF Clone, Rat, N-HA tag RG80115-NY
    Ephrin-A1 cDNA ORF Clone, Rat, C-Myc tag RG80115-CM
    Ephrin-A1 cDNA ORF Clone, Rat, N-Myc tag RG80115-NM
    Ephrin-A1 qPCR Primer Pairs, Rat RP300110

    Ephrin-A1 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Ephrin-A1 cDNA ORF Clone in Cloning Vector, Human HG10882-M
    Ephrin-A1 cDNA ORF Clone, Human, untagged HG10882-UT
    Ephrin-A1 cDNA ORF Clone, Human, C-GFPSpark® tag HG10882-ACG
    Ephrin-A1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10882-ACGLN
    Ephrin-A1 cDNA ORF Clone, Human, C-OFPSpark® tag HG10882-ACR
    Ephrin-A1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10882-CF
    Ephrin-A1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10882-NF
    Ephrin-A1 cDNA ORF Clone, Human, C-His tag HG10882-CH
    Ephrin-A1 cDNA ORF Clone, Human, N-His tag HG10882-NH
    Ephrin-A1 cDNA ORF Clone, Human, C-HA tag HG10882-CY
    Ephrin-A1 cDNA ORF Clone, Human, N-HA tag HG10882-NY
    Ephrin-A1 cDNA ORF Clone, Human, C-Myc tag HG10882-CM
    Ephrin-A1 cDNA ORF Clone, Human, N-Myc tag HG10882-NM
    Ephrin-A1 qPCR Primer Pairs, Human HP100768
    info info
    添加购物车成功! 添加购物车失败!