Quick Order

Rat EDAR/Ectodysplasin A Receptor Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Rat EDAR cDNA Clone Product Information
NCBI RefSeq:NM_001191899.1
RefSeq ORF Size:1347bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ectodysplasin-A receptor with C terminal Myc tag.
Gene Synonym:RGD1561714, Edar
Species:Rat
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member EDAR is a Single-pass type I membrane protein. Edar was expressed reiteratively in signaling centers regulating key steps in morphogenesis. activin signaling from mesenchyme induces the expression of the TNF receptor edar in the epithelial signaling centers, thus making them responsive to Wnt-induced ectodysplasin from the nearby ectoderm. This is the first demonstration of integration of the Wnt, activin, and TNF signaling pathways. Defects in EDAR are a cause of ectodermal dysplasia anhidrotic (EDA), also known ectodermal dysplasia hypohidrotic autosomal recessive (HED). Ectodermal dysplasia defines a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDA is characterized by sparse hair (atrichosis or hypotrichosis), abnormal or missing teeth and the inability to sweat due to the absence of sweat glands.

References
  • Elomaa O, et al. (2001) Ectodysplasin is released by proteolytic shedding and binds to the EDAR protein. Hum Mol Genet. 10 (9): 953-62.
  • Koppinen P, et al. (2001) Signaling and subcellular localization of the TNF receptor Edar. Exp Cell Res. 269 (2): 180-92.
  • Chassaing N, et al. (2006) Mutations in EDAR account for one-quarter of non-ED1-related hypohidrotic ectodermal dysplasia. Hu. Mutat. 27 (3): 255-9.
  • Size / Price
    Catalog: RG80228-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"