Quick Order

Rat XEDAR/EDA2R Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat EDA2R cDNA Clone Product Information
NCBI RefSeq:XM_006227366.2
RefSeq ORF Size:897bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ectodysplasin A2 receptor with C terminal Flag tag.
Gene Synonym:RGD1564025, Eda2r
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Tumor necrosis factor receptor superfamily member 27, also known as X-linked ectodysplasin-A2 receptor, EDA-A2 receptor, EDA2R, XEDAR and TNFRSF27, is a single-pass type I II membrane protein. TNFRSF27 / EDA2R contains three TNFR-Cys repeats. It is a new member of the tumor necrosis factor receptor family that has been shown to be highly expressed in ectodermal derivatives during embryonic development and binds to ectodysplasin-A2 (EDA-A2). TNFRSF27 / EDA2R is a receptor for EDA isoform A2, but not for EDA isoform A1. TNFRSF27 / EDA2R mediates the activation of the NF-kappa-B and JNK pathways. The activation seems to be mediated by binding to TRAF3 and TRAF6. Ectodysplasin, a member of the tumor necrosis factor family, is encoded by the anhidrotic ectodermal dysplasia EDA gene. Mutations in EDA give rise to a clinical syndrome characterized by loss of hair, sweat glands, and teeth. EDA-A1 and EDA-A2 are two isoforms of ectodysplasin that differ only by an insertion of two amino acids. This insertion functions to determine receptor binding specificity, such that EDA-A1 binds only the receptor EDAR, whereas EDA-A2 binds only the related, but distinct, X-linked ectodysplasin-A2 receptor (XEDAR).

References
  • Yan M., et al., 2000,Science. 290: 523-527.
  • Sinha S.K., et al., 2002, J. Biol. Chem. 277: 44953-44961.
  • Prodi, D.A. et al., 2008, J Invest Dermatol  128 (9):2268-70.
  • Size / Price
    Catalog: RG80206-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"