ECHDC1 cDNA ORF Clone, Rat, N-His tag

Cat: RG80492-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ECHDC1 Reagents
CRO Services
Product recommended

All ECHDC1 Reagents
ECHDC1 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
900 bp
Description
Full length Clone DNA of Rat enoyl CoA hydratase domain containing 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ECHDC1 Background Information
Full Name
ethylmalonyl-CoA decarboxylase 1

ECHDC1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
ECHDC1 cDNA ORF Clone in Cloning Vector, Rat RG80492-U
ECHDC1 cDNA ORF Clone, Rat, untagged RG80492-UT
ECHDC1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80492-ACGLN
ECHDC1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80492-ACG
ECHDC1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80492-ANG
ECHDC1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80492-ACR
ECHDC1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80492-ANR
ECHDC1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80492-CF
ECHDC1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80492-NF
ECHDC1 cDNA ORF Clone, Rat, C-His tag RG80492-CH
ECHDC1 cDNA ORF Clone, Rat, C-HA tag RG80492-CY
ECHDC1 cDNA ORF Clone, Rat, N-HA tag RG80492-NY
ECHDC1 cDNA ORF Clone, Rat, C-Myc tag RG80492-CM
ECHDC1 cDNA ORF Clone, Rat, N-Myc tag RG80492-NM
ECHDC1 qPCR Primer Pairs, Rat RP300456

ECHDC1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
ECHDC1 cDNA ORF Clone in Cloning Vector, Mouse MG51891-G
ECHDC1 cDNA ORF Clone, Mouse, untagged MG51891-UT
ECHDC1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51891-ACGLN
ECHDC1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51891-ACG
ECHDC1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51891-ANG
ECHDC1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51891-ACR
ECHDC1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51891-ANR
ECHDC1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51891-CF
ECHDC1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51891-NF
ECHDC1 cDNA ORF Clone, Mouse, C-His tag MG51891-CH
ECHDC1 cDNA ORF Clone, Mouse, N-His tag MG51891-NH
ECHDC1 cDNA ORF Clone, Mouse, C-HA tag MG51891-CY
ECHDC1 cDNA ORF Clone, Mouse, N-HA tag MG51891-NY
ECHDC1 cDNA ORF Clone, Mouse, C-Myc tag MG51891-CM
ECHDC1 cDNA ORF Clone, Mouse, N-Myc tag MG51891-NM
ECHDC1 qPCR Primer Pairs, Mouse MP201764
info info
添加购物车成功! 添加购物车失败!