DSCR3 cDNA ORF Clone, Rat, untagged

Cat: RG81009-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DSCR3 Reagents
CRO Services
Product recommended

All DSCR3 Reagents
DSCR3 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
894 bp
Description
Full length Clone DNA of Rat Down syndrome critical region gene 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DSCR3 Background Information
Full Name
Down syndrome critical region 3

DSCR3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DSCR3 cDNA ORF Clone in Cloning Vector, Rat RG81009-U
DSCR3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81009-ACGLN
DSCR3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81009-ACG
DSCR3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81009-ANG
DSCR3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81009-ACR
DSCR3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81009-ANR
DSCR3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81009-CF
DSCR3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81009-NF
DSCR3 cDNA ORF Clone, Rat, C-His tag RG81009-CH
DSCR3 cDNA ORF Clone, Rat, N-His tag RG81009-NH
DSCR3 cDNA ORF Clone, Rat, C-HA tag RG81009-CY
DSCR3 cDNA ORF Clone, Rat, N-HA tag RG81009-NY
DSCR3 cDNA ORF Clone, Rat, C-Myc tag RG81009-CM
DSCR3 cDNA ORF Clone, Rat, N-Myc tag RG81009-NM
DSCR3 qPCR Primer Pairs, Rat RP300973

DSCR3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DSCR3 cDNA ORF Clone in Cloning Vector, Mouse MG52425-G
DSCR3 cDNA ORF Clone, Mouse, untagged MG52425-UT
DSCR3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52425-ACGLN
DSCR3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52425-ACG
DSCR3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52425-ANG
DSCR3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52425-ACR
DSCR3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52425-ANR
DSCR3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52425-CF
DSCR3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52425-NF
DSCR3 cDNA ORF Clone, Mouse, C-His tag MG52425-CH
DSCR3 cDNA ORF Clone, Mouse, N-His tag MG52425-NH
DSCR3 cDNA ORF Clone, Mouse, C-HA tag MG52425-CY
DSCR3 cDNA ORF Clone, Mouse, N-HA tag MG52425-NY
DSCR3 cDNA ORF Clone, Mouse, C-Myc tag MG52425-CM
DSCR3 cDNA ORF Clone, Mouse, N-Myc tag MG52425-NM
DSCR3 qPCR Primer Pairs, Mouse MP202298

DSCR3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DSCR3 cDNA ORF Clone in Cloning Vector, Human HG16891-U
DSCR3 cDNA ORF Clone, Human, untagged HG16891-UT
DSCR3 cDNA ORF Clone, Human, C-GFPSpark® tag HG16891-ACG
DSCR3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16891-ACGLN
DSCR3 cDNA ORF Clone, Human, N-GFPSpark® tag HG16891-ANG
DSCR3 cDNA ORF Clone, Human, C-OFPSpark® tag HG16891-ACR
DSCR3 cDNA ORF Clone, Human, N-OFPSpark® tag HG16891-ANR
DSCR3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16891-CF
DSCR3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16891-NF
DSCR3 cDNA ORF Clone, Human, C-His tag HG16891-CH
DSCR3 cDNA ORF Clone, Human, N-His tag HG16891-NH
DSCR3 cDNA ORF Clone, Human, C-HA tag HG16891-CY
DSCR3 cDNA ORF Clone, Human, N-HA tag HG16891-NY
DSCR3 cDNA ORF Clone, Human, C-Myc tag HG16891-CM
DSCR3 cDNA ORF Clone, Human, N-Myc tag HG16891-NM
info info
添加购物车成功! 添加购物车失败!