DRG2 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80604-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All DRG2 Reagents
CRO Services
Product recommended

All DRG2 Reagents
DRG2 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1095 bp
Description
Full length Clone DNA of Rat developmentally regulated GTP binding protein 2 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DRG2 Background Information
Full Name
developmentally regulated GTP binding protein 2

DRG2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DRG2 cDNA ORF Clone in Cloning Vector, Rat RG80604-U
DRG2 cDNA ORF Clone, Rat, untagged RG80604-UT
DRG2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80604-ACG
DRG2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80604-ACGLN
DRG2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80604-ANG
DRG2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80604-ACR
DRG2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80604-ANR
DRG2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80604-CF
DRG2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80604-NF
DRG2 cDNA ORF Clone, Rat, C-His tag RG80604-CH
DRG2 cDNA ORF Clone, Rat, N-His tag RG80604-NH
DRG2 cDNA ORF Clone, Rat, C-HA tag RG80604-CY
DRG2 cDNA ORF Clone, Rat, C-Myc tag RG80604-CM
DRG2 cDNA ORF Clone, Rat, N-Myc tag RG80604-NM
DRG2 qPCR Primer Pairs, Rat RP300568

DRG2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DRG2 cDNA ORF Clone in Cloning Vector, Mouse MG52181-U
DRG2 cDNA ORF Clone, Mouse, untagged MG52181-UT
DRG2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52181-ACGLN
DRG2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52181-ACG
DRG2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52181-ANG
DRG2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52181-ACR
DRG2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52181-ANR
DRG2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52181-CF
DRG2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52181-NF
DRG2 cDNA ORF Clone, Mouse, C-His tag MG52181-CH
DRG2 cDNA ORF Clone, Mouse, N-His tag MG52181-NH
DRG2 cDNA ORF Clone, Mouse, C-HA tag MG52181-CY
DRG2 cDNA ORF Clone, Mouse, N-HA tag MG52181-NY
DRG2 cDNA ORF Clone, Mouse, C-Myc tag MG52181-CM
DRG2 cDNA ORF Clone, Mouse, N-Myc tag MG52181-NM
DRG2 qPCR Primer Pairs, Mouse MP202054

DRG2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DRG2 cDNA ORF Clone in Cloning Vector, Human HG14405-G
DRG2 cDNA ORF Clone, Human, untagged HG14405-UT
DRG2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14405-ACGLN
DRG2 cDNA ORF Clone, Human, C-GFPSpark® tag HG14405-ACG
DRG2 cDNA ORF Clone, Human, N-GFPSpark® tag HG14405-ANG
DRG2 cDNA ORF Clone, Human, C-OFPSpark® tag HG14405-ACR
DRG2 cDNA ORF Clone, Human, N-OFPSpark® tag HG14405-ANR
DRG2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14405-CF
DRG2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14405-NF
DRG2 cDNA ORF Clone, Human, C-His tag HG14405-CH
DRG2 cDNA ORF Clone, Human, N-His tag HG14405-NH
DRG2 cDNA ORF Clone, Human, C-HA tag HG14405-CY
DRG2 cDNA ORF Clone, Human, N-HA tag HG14405-NY
DRG2 cDNA ORF Clone, Human, C-Myc tag HG14405-CM
DRG2 cDNA ORF Clone, Human, N-Myc tag HG14405-NM
DRG2 qPCR Primer Pairs, Human HP103054
info info
添加购物车成功! 添加购物车失败!