CRMP4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81263-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRMP4 Reagents
CRO Services
Product recommended

All CRMP4 Reagents
CRMP4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1713 bp
Description
Full length Clone DNA of Rat dihydropyrimidinase-like 3 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRMP4 Background Information
Full Name
dihydropyrimidinase-like 3

CRMP4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CRMP4 cDNA ORF Clone in Cloning Vector, Rat RG81263-U
CRMP4 cDNA ORF Clone, Rat, untagged RG81263-UT
CRMP4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81263-ACG
CRMP4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81263-ACGLN
CRMP4 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81263-ANG
CRMP4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81263-ACR
CRMP4 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81263-ANR
CRMP4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81263-NF
CRMP4 cDNA ORF Clone, Rat, C-His tag RG81263-CH
CRMP4 cDNA ORF Clone, Rat, N-His tag RG81263-NH
CRMP4 cDNA ORF Clone, Rat, C-HA tag RG81263-CY
CRMP4 cDNA ORF Clone, Rat, N-HA tag RG81263-NY
CRMP4 cDNA ORF Clone, Rat, C-Myc tag RG81263-CM
CRMP4 cDNA ORF Clone, Rat, N-Myc tag RG81263-NM
CRMP4 qPCR Primer Pairs, Rat RP301219

CRMP4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRMP4 cDNA ORF Clone in Cloning Vector, Human HG20472-U
CRMP4 cDNA ORF Clone, Human, untagged HG20472-UT
CRMP4 cDNA ORF Clone, Human, C-GFPSpark® tag HG20472-ACG
CRMP4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20472-ACGLN
CRMP4 cDNA ORF Clone, Human, N-GFPSpark® tag HG20472-ANG
CRMP4 cDNA ORF Clone, Human, C-OFPSpark® tag HG20472-ACR
CRMP4 cDNA ORF Clone, Human, N-OFPSpark® tag HG20472-ANR
CRMP4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20472-CF
CRMP4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20472-NF
CRMP4 cDNA ORF Clone, Human, C-His tag HG20472-CH
CRMP4 cDNA ORF Clone, Human, N-His tag HG20472-NH
CRMP4 cDNA ORF Clone, Human, C-HA tag HG20472-CY
CRMP4 cDNA ORF Clone, Human, N-HA tag HG20472-NY
CRMP4 cDNA ORF Clone, Human, C-Myc tag HG20472-CM
CRMP4 cDNA ORF Clone, Human, N-Myc tag HG20472-NM
info info
添加购物车成功! 添加购物车失败!