DCPS cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80880-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCPS Reagents
CRO Services
Product recommended

All DCPS Reagents
DCPS cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Rat decapping enzyme, scavenger with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCPS Background Information
Full Name
decapping enzyme, scavenger

DCPS cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DCPS cDNA ORF Clone in Cloning Vector, Rat RG80880-U
DCPS cDNA ORF Clone, Rat, untagged RG80880-UT
DCPS cDNA ORF Clone, Rat, C-GFPSpark® tag RG80880-ACG
DCPS Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80880-ACGLN
DCPS cDNA ORF Clone, Rat, N-GFPSpark® tag RG80880-ANG
DCPS cDNA ORF Clone, Rat, C-OFPSpark® tag RG80880-ACR
DCPS cDNA ORF Clone, Rat, N-OFPSpark® tag RG80880-ANR
DCPS cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80880-CF
DCPS cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80880-NF
DCPS cDNA ORF Clone, Rat, C-His tag RG80880-CH
DCPS cDNA ORF Clone, Rat, N-His tag RG80880-NH
DCPS cDNA ORF Clone, Rat, C-HA tag RG80880-CY
DCPS cDNA ORF Clone, Rat, N-HA tag RG80880-NY
DCPS cDNA ORF Clone, Rat, C-Myc tag RG80880-CM
DCPS qPCR Primer Pairs, Rat RP300844

DCPS cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCPS cDNA ORF Clone in Cloning Vector, Human HG14384-G
DCPS cDNA ORF Clone, Human, untagged HG14384-UT
DCPS Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14384-ACGLN
DCPS cDNA ORF Clone, Human, C-GFPSpark® tag HG14384-ACG
DCPS cDNA ORF Clone, Human, N-GFPSpark® tag HG14384-ANG
DCPS cDNA ORF Clone, Human, C-OFPSpark® tag HG14384-ACR
DCPS cDNA ORF Clone, Human, N-OFPSpark® tag HG14384-ANR
DCPS cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14384-CF
DCPS cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14384-NF
DCPS cDNA ORF Clone, Human, C-His tag HG14384-CH
DCPS cDNA ORF Clone, Human, N-His tag HG14384-NH
DCPS cDNA ORF Clone, Human, C-HA tag HG14384-CY
DCPS cDNA ORF Clone, Human, N-HA tag HG14384-NY
DCPS cDNA ORF Clone, Human, C-Myc tag HG14384-CM
DCPS cDNA ORF Clone, Human, N-Myc tag HG14384-NM
DCPS qPCR Primer Pairs, Human HP103033
info info
添加购物车成功! 添加购物车失败!