DCAF11 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80931-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DCAF11 Reagents
CRO Services
Product recommended

All DCAF11 Reagents
DCAF11 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1650 bp
Description
Full length Clone DNA of Rat DDB1 and CUL4 associated factor 11 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DCAF11 cDNA ORF Clone, Rat, N-Myc tag Alternative Names
Wdr23 cDNA ORF Clone, Rat
DCAF11 Background Information
Full Name
DDB1 and CUL4 associated factor 11

DCAF11 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DCAF11 cDNA ORF Clone in Cloning Vector, Rat RG80931-U
DCAF11 cDNA ORF Clone, Rat, untagged RG80931-UT
DCAF11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80931-ACG
DCAF11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80931-ACGLN
DCAF11 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80931-ANG
DCAF11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80931-ACR
DCAF11 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80931-ANR
DCAF11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80931-CF
DCAF11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80931-NF
DCAF11 cDNA ORF Clone, Rat, C-His tag RG80931-CH
DCAF11 cDNA ORF Clone, Rat, N-His tag RG80931-NH
DCAF11 cDNA ORF Clone, Rat, C-HA tag RG80931-CY
DCAF11 cDNA ORF Clone, Rat, N-HA tag RG80931-NY
DCAF11 cDNA ORF Clone, Rat, C-Myc tag RG80931-CM
DCAF11 qPCR Primer Pairs, Rat RP300895

DCAF11 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
DCAF11 cDNA ORF Clone in Cloning Vector, Mouse MG53511-U
DCAF11 cDNA ORF Clone, Mouse, untagged MG53511-UT
DCAF11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53511-ACG
DCAF11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53511-ACGLN
DCAF11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53511-ANG
DCAF11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53511-ACR
DCAF11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53511-ANR
DCAF11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53511-CF
DCAF11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53511-NF
DCAF11 cDNA ORF Clone, Mouse, C-His tag MG53511-CH
DCAF11 cDNA ORF Clone, Mouse, N-His tag MG53511-NH
DCAF11 cDNA ORF Clone, Mouse, C-HA tag MG53511-CY
DCAF11 cDNA ORF Clone, Mouse, N-HA tag MG53511-NY
DCAF11 cDNA ORF Clone, Mouse, C-Myc tag MG53511-CM
DCAF11 cDNA ORF Clone, Mouse, N-Myc tag MG53511-NM

DCAF11 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DCAF11 cDNA ORF Clone in Cloning Vector, Human HG16257-G
DCAF11 cDNA ORF Clone in Cloning Vector, Human HG29671-U
DCAF11 cDNA ORF Clone, Human, untagged HG16257-UT
DCAF11 cDNA ORF Clone, Human, C-GFPSpark® tag HG16257-ACG
DCAF11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG29671-ACGLN
DCAF11 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16257-ACGLN
DCAF11 cDNA ORF Clone, Human, N-GFPSpark® tag HG16257-ANG
DCAF11 cDNA ORF Clone, Human, C-OFPSpark® tag HG16257-ACR
DCAF11 cDNA ORF Clone, Human, N-OFPSpark® tag HG16257-ANR
DCAF11 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16257-CF
DCAF11 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16257-NF
DCAF11 cDNA ORF Clone, Human, C-His tag HG16257-CH
DCAF11 cDNA ORF Clone, Human, N-His tag HG16257-NH
DCAF11 cDNA ORF Clone, Human, C-HA tag HG16257-CY
DCAF11 cDNA ORF Clone, Human, N-HA tag HG16257-NY
DCAF11 cDNA ORF Clone, Human, C-Myc tag HG16257-CM
DCAF11 cDNA ORF Clone, Human, N-Myc tag HG16257-NM
DCAF11 qPCR Primer Pairs, Human HP105020
info info
添加购物车成功! 添加购物车失败!