DAP1 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81226-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All DAP1 Reagents
CRO Services
Product recommended

All DAP1 Reagents
DAP1 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
309 bp
Description
Full length Clone DNA of Rat death-associated protein with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

DAP1 Background Information
Full Name
death-associated protein

DAP1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
DAP1 cDNA ORF Clone in Cloning Vector, Rat RG81226-U
DAP1 cDNA ORF Clone, Rat, untagged RG81226-UT
DAP1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81226-ACG
DAP1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81226-ACGLN
DAP1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81226-ANG
DAP1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81226-ACR
DAP1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81226-ANR
DAP1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81226-CF
DAP1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81226-NF
DAP1 cDNA ORF Clone, Rat, C-His tag RG81226-CH
DAP1 cDNA ORF Clone, Rat, N-His tag RG81226-NH
DAP1 cDNA ORF Clone, Rat, C-HA tag RG81226-CY
DAP1 cDNA ORF Clone, Rat, N-HA tag RG81226-NY
DAP1 cDNA ORF Clone, Rat, N-Myc tag RG81226-NM
DAP1 qPCR Primer Pairs, Rat RP301182

DAP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
DAP1 cDNA ORF Clone in Cloning Vector, Human HG14921-G
DAP1 cDNA ORF Clone, Human, untagged HG14921-UT
DAP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14921-ACGLN
DAP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14921-ACG
DAP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14921-ANG
DAP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14921-ACR
DAP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14921-ANR
DAP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14921-CF
DAP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14921-NF
DAP1 cDNA ORF Clone, Human, C-His tag HG14921-CH
DAP1 cDNA ORF Clone, Human, N-His tag HG14921-NH
DAP1 cDNA ORF Clone, Human, C-HA tag HG14921-CY
DAP1 cDNA ORF Clone, Human, N-HA tag HG14921-NY
DAP1 cDNA ORF Clone, Human, C-Myc tag HG14921-CM
DAP1 cDNA ORF Clone, Human, N-Myc tag HG14921-NM
DAP1 qPCR Primer Pairs, Human HP103550
info info
添加购物车成功! 添加购物车失败!