Cadherin 8 cDNA ORF Clone, Rat, untagged

Cat: RG80278-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Cadherin 8 Reagents
CRO Services
Product recommended

All Cadherin 8 Reagents
Cadherin 8 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2400 bp
Description
Full length Clone DNA of Rat cadherin 8.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cadherin 8 Background Information

Cadherins are integral membrane proteins that mediate calcium-dependent cell-cell adhesion. Type I cadherin proteins are composed of a large N-terminal extracellular domain, a single membrane-spanning domain, and a small, highly conserved C-terminal cytoplasmic domain. The extracellular domain consists of five subdomains, each containing a cadherin motif, and appears to determine the specificity of the protein's homophilic cell adhesion activity. Type II (atypical) cadherins are defined based on their lack of a HAV cell adhesion recognition sequence specific to type I  cadherins. Cadherin 8, also known as CDH 8, is a type I I classical cadherin belonging to the cadherin superfamily. As mainly expressed in brain, CDH8 is found in certain nerve cell lines, such as retinoblasts, glioma cells and neuroblasts, and is putatively involved in synaptic adhesion, axon outgrowth and guidance. Human Cadherin 8 is a 799 amino acid single-pass type I  transmembrane protein with a putative 29 aa signal sequence, and a 32 aa propeptide, a 560 aa mature extracellular domain, a 21 aa transmembrane domain and a 157 aa cytoplasmic domain. The human, mouse and rat proteins share approximately 98% homology.

Full Name
cadherin 8, type 2
References
  • Tanihara, H. et al., 1994, Cell Adhes. Comm. 2:15-26.
  • Kido, M. et al., 1998, Genomics 48:186-194.
  • Yamagata, K. et al., 1999, J. Biol. Chem. 274:19473-19479.
  • Nollet, F. et al., 2000, J. Mol. Biol. 299:551-572.
  • Blaschke, S. et al., 2002, Int. J. Cancer. 101 (4): 327-334.
  • Strausberg,R.L. et al., 2003, Proc. Natl. Acad. Sci. U.S.A. 99 (26): 16899–16903.
  • Cadherin 8 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cadherin 8 cDNA ORF Clone in Cloning Vector, Rat RG80278-G
    Cadherin 8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80278-ACG
    Cadherin 8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80278-ACGLN
    Cadherin 8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80278-ACR
    Cadherin 8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80278-CF
    Cadherin 8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80278-NF
    Cadherin 8 cDNA ORF Clone, Rat, C-His tag RG80278-CH
    Cadherin 8 cDNA ORF Clone, Rat, N-His tag RG80278-NH
    Cadherin 8 cDNA ORF Clone, Rat, C-HA tag RG80278-CY
    Cadherin 8 cDNA ORF Clone, Rat, N-HA tag RG80278-NY
    Cadherin 8 cDNA ORF Clone, Rat, C-Myc tag RG80278-CM
    Cadherin 8 cDNA ORF Clone, Rat, N-Myc tag RG80278-NM
    Cadherin 8 qPCR Primer Pairs, Rat RP300257

    Cadherin 8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cadherin 8 cDNA ORF Clone in Cloning Vector, Human HG10144-M
    Cadherin 8 cDNA ORF Clone, Human, untagged HG10144-UT
    Cadherin 8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10144-ACG
    Cadherin 8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10144-ACGLN
    Cadherin 8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10144-ACR
    Cadherin 8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10144-CF
    Cadherin 8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10144-NF
    Cadherin 8 cDNA ORF Clone, Human, C-His tag HG10144-CH
    Cadherin 8 cDNA ORF Clone, Human, N-His tag HG10144-NH
    Cadherin 8 cDNA ORF Clone, Human, C-HA tag HG10144-CY
    Cadherin 8 cDNA ORF Clone, Human, N-HA tag HG10144-NY
    Cadherin 8 cDNA ORF Clone, Human, C-Myc tag HG10144-CM
    Cadherin 8 cDNA ORF Clone, Human, N-Myc tag HG10144-NM
    Cadherin 8 qPCR Primer Pairs, Human HP100215
    info info
    添加购物车成功! 添加购物车失败!