CYSTM1 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80803-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CYSTM1 Reagents
CRO Services
Product recommended

All CYSTM1 Reagents
CYSTM1 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
306 bp
Description
Full length Clone DNA of Rat cysteine-rich transmembrane module containing 1 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CYSTM1 Background Information
Full Name
cysteine-rich transmembrane module containing 1

CYSTM1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CYSTM1 cDNA ORF Clone in Cloning Vector, Rat RG80803-U
CYSTM1 cDNA ORF Clone, Rat, untagged RG80803-UT
CYSTM1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80803-ACGLN
CYSTM1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80803-ACG
CYSTM1 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80803-ANG
CYSTM1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80803-ACR
CYSTM1 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80803-ANR
CYSTM1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80803-CF
CYSTM1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80803-NF
CYSTM1 cDNA ORF Clone, Rat, C-His tag RG80803-CH
CYSTM1 cDNA ORF Clone, Rat, N-His tag RG80803-NH
CYSTM1 cDNA ORF Clone, Rat, C-HA tag RG80803-CY
CYSTM1 cDNA ORF Clone, Rat, N-HA tag RG80803-NY
CYSTM1 cDNA ORF Clone, Rat, C-Myc tag RG80803-CM
CYSTM1 qPCR Primer Pairs, Rat RP300767

CYSTM1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CYSTM1 cDNA ORF Clone in Cloning Vector, Mouse MG52576-G
CYSTM1 cDNA ORF Clone, Mouse, untagged MG52576-UT
CYSTM1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52576-ACGLN
CYSTM1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52576-ACG
CYSTM1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52576-ANG
CYSTM1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52576-ACR
CYSTM1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52576-ANR
CYSTM1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52576-CF
CYSTM1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52576-NF
CYSTM1 cDNA ORF Clone, Mouse, C-His tag MG52576-CH
CYSTM1 cDNA ORF Clone, Mouse, N-His tag MG52576-NH
CYSTM1 cDNA ORF Clone, Mouse, C-HA tag MG52576-CY
CYSTM1 cDNA ORF Clone, Mouse, N-HA tag MG52576-NY
CYSTM1 cDNA ORF Clone, Mouse, C-Myc tag MG52576-CM
CYSTM1 cDNA ORF Clone, Mouse, N-Myc tag MG52576-NM
CYSTM1 qPCR Primer Pairs, Mouse MP202447
info info
添加购物车成功! 添加购物车失败!