Cytochrome c cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81286-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytochrome c Reagents
CRO Services
Product recommended

All Cytochrome c Reagents
Cytochrome c cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
318 bp
Description
Full length Clone DNA of Rat cytochrome c, somatic with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytochrome c Background Information
Full Name
cytochrome c, somatic

Cytochrome c cDNA ORF Clone, Canine, Related Products

Product Name Catalog#(PDF)
Cytochrome c cDNA ORF Clone in Cloning Vector, Canine DG70210-U
Cytochrome c cDNA ORF Clone, Canine, untagged DG70210-UT
Cytochrome c Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70210-ACGLN
Cytochrome c cDNA ORF Clone, Canine, C-GFPSpark® tag DG70210-ACG
Cytochrome c cDNA ORF Clone, Canine, N-GFPSpark® tag DG70210-ANG
Cytochrome c cDNA ORF Clone, Canine, C-OFPSpark® tag DG70210-ACR
Cytochrome c cDNA ORF Clone, Canine, N-OFPSpark® tag DG70210-ANR
Cytochrome c cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70210-CF
Cytochrome c cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70210-NF
Cytochrome c cDNA ORF Clone, Canine, C-His tag DG70210-CH
Cytochrome c cDNA ORF Clone, Canine, N-His tag DG70210-NH
Cytochrome c cDNA ORF Clone, Canine, C-HA tag DG70210-CY
Cytochrome c cDNA ORF Clone, Canine, N-HA tag DG70210-NY
Cytochrome c cDNA ORF Clone, Canine, C-Myc tag DG70210-CM
Cytochrome c cDNA ORF Clone, Canine, N-Myc tag DG70210-NM

Cytochrome c cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Cytochrome c cDNA ORF Clone in Cloning Vector, Rhesus CG90610-G
Cytochrome c cDNA ORF Clone, Rhesus, untagged CG90610-UT
Cytochrome c Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90610-ACGLN
Cytochrome c cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90610-ACG
Cytochrome c cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90610-ANG
Cytochrome c cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90610-ACR
Cytochrome c cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90610-ANR
Cytochrome c cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90610-CF
Cytochrome c cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90610-NF
Cytochrome c cDNA ORF Clone, Rhesus, C-His tag CG90610-CH
Cytochrome c cDNA ORF Clone, Rhesus, N-His tag CG90610-NH
Cytochrome c cDNA ORF Clone, Rhesus, C-HA tag CG90610-CY
Cytochrome c cDNA ORF Clone, Rhesus, N-HA tag CG90610-NY
Cytochrome c cDNA ORF Clone, Rhesus, C-Myc tag CG90610-CM
Cytochrome c cDNA ORF Clone, Rhesus, N-Myc tag CG90610-NM

Cytochrome c cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytochrome c cDNA ORF Clone in Cloning Vector, Rat RG81286-U
Cytochrome c cDNA ORF Clone, Rat, untagged RG81286-UT
Cytochrome c cDNA ORF Clone, Rat, C-GFPSpark® tag RG81286-ACG
Cytochrome c Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81286-ACGLN
Cytochrome c cDNA ORF Clone, Rat, N-GFPSpark® tag RG81286-ANG
Cytochrome c cDNA ORF Clone, Rat, C-OFPSpark® tag RG81286-ACR
Cytochrome c cDNA ORF Clone, Rat, N-OFPSpark® tag RG81286-ANR
Cytochrome c cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81286-CF
Cytochrome c cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81286-NF
Cytochrome c cDNA ORF Clone, Rat, C-His tag RG81286-CH
Cytochrome c cDNA ORF Clone, Rat, N-His tag RG81286-NH
Cytochrome c cDNA ORF Clone, Rat, C-HA tag RG81286-CY
Cytochrome c cDNA ORF Clone, Rat, N-HA tag RG81286-NY
Cytochrome c cDNA ORF Clone, Rat, N-Myc tag RG81286-NM
Cytochrome c qPCR Primer Pairs, Rat RP301242

Cytochrome c cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytochrome c cDNA ORF Clone in Cloning Vector, Mouse MG51264-U
Cytochrome c cDNA ORF Clone, Mouse, untagged MG51264-UT
Cytochrome c Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51264-ACGLN
Cytochrome c cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51264-ACG
Cytochrome c cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51264-ANG
Cytochrome c cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51264-ACR
Cytochrome c cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51264-ANR
Cytochrome c cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51264-CF
Cytochrome c cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51264-NF
Cytochrome c cDNA ORF Clone, Mouse, C-His tag MG51264-CH
Cytochrome c cDNA ORF Clone, Mouse, N-His tag MG51264-NH
Cytochrome c cDNA ORF Clone, Mouse, C-HA tag MG51264-CY
Cytochrome c cDNA ORF Clone, Mouse, N-HA tag MG51264-NY
Cytochrome c cDNA ORF Clone, Mouse, C-Myc tag MG51264-CM
Cytochrome c cDNA ORF Clone, Mouse, N-Myc tag MG51264-NM
Cytochrome c qPCR Primer Pairs, Mouse MP201146

Cytochrome c cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytochrome c cDNA ORF Clone in Cloning Vector, Human HG16981-U
Cytochrome c cDNA ORF Clone, Human, untagged HG16981-UT
Cytochrome c cDNA ORF Clone, Human, C-GFPSpark® tag HG16981-ACG
Cytochrome c Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16981-ACGLN
Cytochrome c cDNA ORF Clone, Human, N-GFPSpark® tag HG16981-ANG
Cytochrome c cDNA ORF Clone, Human, C-OFPSpark® tag HG16981-ACR
Cytochrome c cDNA ORF Clone, Human, N-OFPSpark® tag HG16981-ANR
Cytochrome c cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16981-CF
Cytochrome c cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16981-NF
Cytochrome c cDNA ORF Clone, Human, C-His tag HG16981-CH
Cytochrome c cDNA ORF Clone, Human, N-His tag HG16981-NH
Cytochrome c cDNA ORF Clone, Human, C-HA tag HG16981-CY
Cytochrome c cDNA ORF Clone, Human, N-HA tag HG16981-NY
Cytochrome c cDNA ORF Clone, Human, C-Myc tag HG16981-CM
Cytochrome c cDNA ORF Clone, Human, N-Myc tag HG16981-NM
info info
添加购物车成功! 添加购物车失败!