Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-HA tag

Cat: RG80754-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cytochrome b5/CYB5A Reagents
CRO Services
Product recommended

All Cytochrome b5/CYB5A Reagents
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
405 bp
Description
Full length Clone DNA of Rat cytochrome b5 type A (microsomal) with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cytochrome b5/CYB5A Background Information
Full Name
cytochrome b5 type A (microsomal)

Cytochrome b5/CYB5A cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Cytochrome b5/CYB5A cDNA ORF Clone in Cloning Vector, Rat RG80754-U
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, untagged RG80754-UT
Cytochrome b5/CYB5A Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80754-ACGLN
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-GFPSpark® tag RG80754-ACG
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-GFPSpark® tag RG80754-ANG
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-OFPSpark® tag RG80754-ACR
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-OFPSpark® tag RG80754-ANR
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80754-CF
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80754-NF
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-His tag RG80754-CH
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-His tag RG80754-NH
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-HA tag RG80754-CY
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, C-Myc tag RG80754-CM
Cytochrome b5/CYB5A cDNA ORF Clone, Rat, N-Myc tag RG80754-NM
Cytochrome b5/CYB5A qPCR Primer Pairs, Rat RP300718

Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Cytochrome b5/CYB5A cDNA ORF Clone in Cloning Vector, Mouse MG53795-U
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, untagged MG53795-UT
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53795-ACG
Cytochrome b5/CYB5A Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53795-ACGLN
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53795-ANG
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53795-ACR
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53795-ANR
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53795-CF
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53795-NF
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-His tag MG53795-CH
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-His tag MG53795-NH
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-HA tag MG53795-CY
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-HA tag MG53795-NY
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, C-Myc tag MG53795-CM
Cytochrome b5/CYB5A cDNA ORF Clone, Mouse, N-Myc tag MG53795-NM

Cytochrome b5/CYB5A cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Cytochrome b5/CYB5A cDNA ORF Clone in Cloning Vector, Human HG18362-U
Cytochrome b5/CYB5A Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18362-ACGLN
info info
添加购物车成功! 添加购物车失败!