Quick Order

Rat CXCL10 / Crg-2 Gene ORF cDNA clone expression plasmid, C-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CXCL10 cDNA Clone Product Information
    NCBI RefSeq:NM_139089.1
    RefSeq ORF Size:297bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus chemokine (C-X-C motif) ligand 10 with C terminal Flag tag.
    Gene Synonym:IP-10,Scyb10
    Species:Rat
    Vector:pCMV3-C-FLAG
    Plasmid:
    Restriction Site:
    Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CXCL10 qPCR primers for gene expression analysis, RP300055 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Product nameProduct name
    Background

    CXCL10, also known as crg-2, is a chemokine of the CXC subfamily and ligand for the receptor CXCR3. CXC chemokines are particularly significant for leukocyte infiltration in inflammatory diseases. CXCL10 has a three-dimensional crystal structure. Its signaling is mediated by the g protein-coupled receptor CXCR3, which is expressed on activated T cells and plays an important role in directing the migration of T cells, especially during Th1 responses. Binding of CXCL10 to CXCR3 results in pleiotropic effects, including stimulation of monocytes, natural killer and T-cell migration, and modulation of adhesion molecule expression. It is chemotactic for monocytes and T-lymphocytes. CXCL10 can be secreted by several cell types in response to IFN-γ. Baseline pre-treatment plasma levels of CXCL10 are elevated in patients chronically infected with hepatitis C virus (HCV) of genotypes 1 or 4 who do not achieve a sustained viral response (SVR) after completion of antiviral therapy.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • O'Donovan N, et al. (1999) Physical mapping of the CXC chemokine locus on human chromosome 4. Cytogenet. Cell Genet. 84(1-2):39-42.
  • Swaminathan GJ, et al. (2003) Crystal structures of oligomeric forms of the IP-10/CXCL10 chemokine. Structure. 11(5):521-32.
  • Booth V, et al. (2002) The CXCR3 binding chemokine IP-10/CXCL10: structure and receptor interactions. Biochemistry. 41(33):10418-25.
  • Size / Price
    Catalog: RG80057-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"