Cathepsin D cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81328-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Cathepsin D Reagents
CRO Services
Product recommended

All Cathepsin D Reagents
Cathepsin D cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1224 bp
Description
Full length Clone DNA of Rat cathepsin D with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Cathepsin D Background Information

Cathepsin D (CTSD), a well known lysosomal aspartyl protease and belongs to the peptidase C1 family, which is a normal and major component of lysosomes, and is found in almost all cells and tissues of mammals. Its mostly described function is intracellular catabolism in lysosomal compartments, other physiological effect include hormone and antigen processing. Cathepsin D has a specificity similar to but narrower than that of pepsin A. Cathepsin D plays an important role in the degradation of proteins, the generation of bioactive proteins, antigen processing, etc. Among different role in cell physiology, a new function of this enzyme is examined. Cathepsin D is an important regulator of apoptotic pathways in cells. It acts at different stage of intrinsic and extrinsic pathway of apoptosis. In addition, CTSD secreted from human prostate carcinoma cells are responsible for the generation of angiostatin, a potent endogenous inhibitor of angiogenesis, suggesting its contribution to the prevention of tumor growth and angiogenesis-dependent growth of metastases.

Full Name
cathepsin D
References
  • Fusek M, et al. (2005) Dual role of cathepsin D: ligand and protease. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub. 149(1): 43-50.
  • Minarowska A, et al. (2007) Regulatory role of cathepsin D in apoptosis. Folia Histochem Cytobiol. 45(3): 159-63.
  • Zaidi N, et al. (2008) Cathepsin D: a cellular roadmap. Biochem Biophys Res Commun. 376(1): 5-9.
  • Cathepsin D cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Cathepsin D cDNA ORF Clone in Cloning Vector, Rat RG81328-U
    Cathepsin D cDNA ORF Clone, Rat, untagged RG81328-UT
    Cathepsin D Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81328-ACGLN
    Cathepsin D cDNA ORF Clone, Rat, C-GFPSpark® tag RG81328-ACG
    Cathepsin D cDNA ORF Clone, Rat, C-OFPSpark® tag RG81328-ACR
    Cathepsin D cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81328-NF
    Cathepsin D cDNA ORF Clone, Rat, C-His tag RG81328-CH
    Cathepsin D cDNA ORF Clone, Rat, N-His tag RG81328-NH
    Cathepsin D cDNA ORF Clone, Rat, C-HA tag RG81328-CY
    Cathepsin D cDNA ORF Clone, Rat, N-HA tag RG81328-NY
    Cathepsin D cDNA ORF Clone, Rat, C-Myc tag RG81328-CM
    Cathepsin D cDNA ORF Clone, Rat, N-Myc tag RG81328-NM
    Cathepsin D qPCR Primer Pairs, Rat RP301273

    Cathepsin D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Cathepsin D cDNA ORF Clone in Cloning Vector, Mouse MG50127-M
    Cathepsin D cDNA ORF Clone, Mouse, untagged MG50127-UT
    Cathepsin D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50127-ACG
    Cathepsin D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50127-ACGLN
    Cathepsin D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50127-ACR
    Cathepsin D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50127-CF
    Cathepsin D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50127-NF
    Cathepsin D cDNA ORF Clone, Mouse, C-His tag MG50127-CH
    Cathepsin D cDNA ORF Clone, Mouse, N-His tag MG50127-NH
    Cathepsin D cDNA ORF Clone, Mouse, C-HA tag MG50127-CY
    Cathepsin D cDNA ORF Clone, Mouse, N-HA tag MG50127-NY
    Cathepsin D cDNA ORF Clone, Mouse, C-Myc tag MG50127-CM
    Cathepsin D cDNA ORF Clone, Mouse, N-Myc tag MG50127-NM
    Cathepsin D qPCR Primer Pairs, Mouse MP200157

    Cathepsin D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Cathepsin D cDNA ORF Clone in Cloning Vector, Human HG12517-U
    Cathepsin D cDNA ORF Clone, Human, untagged HG12517-UT
    Cathepsin D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12517-ACGLN
    Cathepsin D cDNA ORF Clone, Human, C-GFPSpark® tag HG12517-ACG
    Cathepsin D cDNA ORF Clone, Human, C-OFPSpark® tag HG12517-ACR
    Cathepsin D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12517-CF
    Cathepsin D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12517-NF
    Cathepsin D cDNA ORF Clone, Human, C-His tag HG12517-CH
    Cathepsin D cDNA ORF Clone, Human, N-His tag HG12517-NH
    Cathepsin D cDNA ORF Clone, Human, C-HA tag HG12517-CY
    Cathepsin D cDNA ORF Clone, Human, N-HA tag HG12517-NY
    Cathepsin D cDNA ORF Clone, Human, C-Myc tag HG12517-CM
    Cathepsin D cDNA ORF Clone, Human, N-Myc tag HG12517-NM
    Cathepsin D qPCR Primer Pairs, Human HP104832
    info info
    添加购物车成功! 添加购物车失败!