CTRB1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81290-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CTRB1 Reagents
CRO Services
Product recommended

All CTRB1 Reagents
CTRB1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
792 bp
Description
Full length Clone DNA of Rat chymotrypsinogen B1 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CTRB1 Background Information
Full Name
chymotrypsinogen B1

CTRB1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CTRB1 cDNA ORF Clone in Cloning Vector, Rat RG81290-U
CTRB1 cDNA ORF Clone, Rat, untagged RG81290-UT
CTRB1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81290-ACG
CTRB1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81290-ACGLN
CTRB1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81290-ACR
CTRB1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81290-NF
CTRB1 cDNA ORF Clone, Rat, C-His tag RG81290-CH
CTRB1 cDNA ORF Clone, Rat, N-His tag RG81290-NH
CTRB1 cDNA ORF Clone, Rat, C-HA tag RG81290-CY
CTRB1 cDNA ORF Clone, Rat, N-HA tag RG81290-NY
CTRB1 cDNA ORF Clone, Rat, C-Myc tag RG81290-CM
CTRB1 cDNA ORF Clone, Rat, N-Myc tag RG81290-NM
CTRB1 qPCR Primer Pairs, Rat RP301246

CTRB1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CTRB1 cDNA ORF Clone in Cloning Vector, Mouse MG52873-G
CTRB1 cDNA ORF Clone, Mouse, untagged MG52873-UT
CTRB1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52873-ACGLN
CTRB1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52873-ACG
CTRB1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52873-ANG
CTRB1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52873-ACR
CTRB1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52873-ANR
CTRB1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52873-CF
CTRB1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52873-NF
CTRB1 cDNA ORF Clone, Mouse, C-His tag MG52873-CH
CTRB1 cDNA ORF Clone, Mouse, N-His tag MG52873-NH
CTRB1 cDNA ORF Clone, Mouse, C-HA tag MG52873-CY
CTRB1 cDNA ORF Clone, Mouse, N-HA tag MG52873-NY
CTRB1 cDNA ORF Clone, Mouse, C-Myc tag MG52873-CM
CTRB1 cDNA ORF Clone, Mouse, N-Myc tag MG52873-NM
info info
添加购物车成功! 添加购物车失败!