CROT cDNA ORF Clone, Rat, C-His tag

Cat: RG81062-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CROT Reagents
CRO Services
Product recommended

All CROT Reagents
CROT cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1839 bp
Description
Full length Clone DNA of Rat carnitine O-octanoyltransferase with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CROT Background Information

Carnitine octanoyltransferase (CROT or COT), also known as octanoyl-CoA: L-carnitine O-octanoyltransferase, medium-chain/long-chain carnitine acyltransferase, and carnitine medium-chain acyltransferase, is a carnitine acyltransferase belonging to the family of transferases, specifically those acyltransferases transferring groups other than aminoacyl groups that catalyzes the reversible transfer of fatty acyl groups between CoA and carnitine. Carnitine octanoyltransferase (CROT or COT) facilitate the transport of medium- and long-chain fatty acids through the peroxisomal and mitochondrial membranes. It is physiologically inhibited by malonyl-CoA. COT also has functions in efficiently converting one of the end products of the peroxisomal beta-oxidation of pristanic acid, 4, 8-dimethylnonanoyl-CoA, to its corresponding carnitine ester. 

Full Name
carnitine O-octanoyltransferase
References
  • Ferdinandusse S, et al. (1999) Molecular cloning and expression of human carnitine octanoyltransferase: evidence for its role in the peroxisomal beta-oxidation of branched-chain fatty acids. Biochem Biophys Res Commun. 263 (1): 213-8.
  • Feike R, et al. (2000) Genomics of the Human Carnitine Acyltransferase Genes. Molecular Genetics and Metabolism. 71 (1-2): 139-53.
  • Montserrat Morillas, et al. (2002) Structural Model of a Malonyl-CoA-binding Site of Carnitine Octanoyltransferase and Carnitine Palmitoyltransferase I. The Journal of Biological Chemistry, 277: 11473-80.
  • CROT cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CROT cDNA ORF Clone in Cloning Vector, Rat RG8A6881-U
    CROT cDNA ORF Clone in Cloning Vector, Rat RG81062-U
    CROT cDNA ORF Clone, Rat, untagged RG81062-UT
    CROT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A6881-ACGLN
    CROT Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81062-ACGLN
    CROT cDNA ORF Clone, Rat, C-GFPSpark® tag RG81062-ACG
    CROT cDNA ORF Clone, Rat, N-GFPSpark® tag RG81062-ANG
    CROT cDNA ORF Clone, Rat, C-OFPSpark® tag RG81062-ACR
    CROT cDNA ORF Clone, Rat, N-OFPSpark® tag RG81062-ANR
    CROT cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81062-CF
    CROT cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81062-NF
    CROT cDNA ORF Clone, Rat, N-His tag RG81062-NH
    CROT cDNA ORF Clone, Rat, C-HA tag RG81062-CY
    CROT cDNA ORF Clone, Rat, N-HA tag RG81062-NY
    CROT cDNA ORF Clone, Rat, C-Myc tag RG81062-CM
    CROT cDNA ORF Clone, Rat, N-Myc tag RG81062-NM
    CROT qPCR Primer Pairs, Rat RP301026

    CROT cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CROT cDNA ORF Clone in Cloning Vector, Mouse MG53241-U
    CROT cDNA ORF Clone, Mouse, untagged MG53241-UT
    CROT Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53241-ACGLN
    CROT cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53241-ACG
    CROT cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53241-ANG
    CROT cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53241-ACR
    CROT cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53241-ANR
    CROT cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53241-CF
    CROT cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53241-NF
    CROT cDNA ORF Clone, Mouse, C-His tag MG53241-CH
    CROT cDNA ORF Clone, Mouse, N-His tag MG53241-NH
    CROT cDNA ORF Clone, Mouse, C-HA tag MG53241-CY
    CROT cDNA ORF Clone, Mouse, N-HA tag MG53241-NY
    CROT cDNA ORF Clone, Mouse, C-Myc tag MG53241-CM
    CROT cDNA ORF Clone, Mouse, N-Myc tag MG53241-NM

    CROT cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CROT cDNA ORF Clone in Cloning Vector, Human HG11015-M
    CROT cDNA ORF Clone, Human, untagged HG11015-UT
    CROT cDNA ORF Clone, Human, C-GFPSpark® tag HG11015-ACG
    CROT Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11015-ACGLN
    CROT cDNA ORF Clone, Human, C-OFPSpark® tag HG11015-ACR
    CROT cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11015-CF
    CROT cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11015-NF
    CROT cDNA ORF Clone, Human, C-His tag HG11015-CH
    CROT cDNA ORF Clone, Human, N-His tag HG11015-NH
    CROT cDNA ORF Clone, Human, C-HA tag HG11015-CY
    CROT cDNA ORF Clone, Human, N-HA tag HG11015-NY
    CROT cDNA ORF Clone, Human, C-Myc tag HG11015-CM
    CROT cDNA ORF Clone, Human, N-Myc tag HG11015-NM
    CROT qPCR Primer Pairs, Human HP100976
    info info
    添加购物车成功! 添加购物车失败!