CRLF3 cDNA ORF Clone, Rat, N-His tag

Cat: RG80591-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRLF3 Reagents
CRO Services
Product recommended

All CRLF3 Reagents
CRLF3 cDNA ORF Clone, Rat, N-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1329 bp
Description
Full length Clone DNA of Rat cytokine receptor-like factor 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRLF3 Background Information
Full Name
cytokine receptor-like factor 3

CRLF3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CRLF3 cDNA ORF Clone in Cloning Vector, Rat RG80591-U
CRLF3 cDNA ORF Clone, Rat, untagged RG80591-UT
CRLF3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80591-ACG
CRLF3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80591-ACGLN
CRLF3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80591-ANG
CRLF3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80591-ACR
CRLF3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80591-ANR
CRLF3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80591-CF
CRLF3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80591-NF
CRLF3 cDNA ORF Clone, Rat, C-His tag RG80591-CH
CRLF3 cDNA ORF Clone, Rat, C-HA tag RG80591-CY
CRLF3 cDNA ORF Clone, Rat, N-HA tag RG80591-NY
CRLF3 cDNA ORF Clone, Rat, C-Myc tag RG80591-CM
CRLF3 cDNA ORF Clone, Rat, N-Myc tag RG80591-NM
CRLF3 qPCR Primer Pairs, Rat RP300555

CRLF3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CRLF3 cDNA ORF Clone in Cloning Vector, Mouse MG5A5422-U
CRLF3 cDNA ORF Clone, Mouse, untagged MG5A5422-UT
CRLF3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5422-ACG
CRLF3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A5422-ACGLN
CRLF3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A5422-ANG
CRLF3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A5422-ACR
CRLF3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A5422-ANR
CRLF3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A5422-CF
CRLF3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A5422-NF
CRLF3 cDNA ORF Clone, Mouse, C-His tag MG5A5422-CH
CRLF3 cDNA ORF Clone, Mouse, N-His tag MG5A5422-NH
CRLF3 cDNA ORF Clone, Mouse, C-HA tag MG5A5422-CY
CRLF3 cDNA ORF Clone, Mouse, N-HA tag MG5A5422-NY
CRLF3 cDNA ORF Clone, Mouse, C-Myc tag MG5A5422-CM
CRLF3 cDNA ORF Clone, Mouse, N-Myc tag MG5A5422-NM

CRLF3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRLF3 cDNA ORF Clone in Cloning Vector, Human HG18069-U
CRLF3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG18069-ACGLN
info info
添加购物车成功! 添加购物车失败!