CRIP2 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG81186-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRIP2 Reagents
CRO Services
Product recommended

All CRIP2 Reagents
CRIP2 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
627 bp
Description
Full length Clone DNA of Rat cysteine-rich protein 2 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRIP2 Background Information

CRIP2 is a putative transcription factor. It has a widespread tissue expression and is highly expressed in heart. CRIP2 contains two LIM zinc-binding domains. CRIP2 may participate in the differentiation of smooth muscle tissue. It also plays an important role in esophageal squamous cell carcinoma (ESCC) tumorigenesis. CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis. It interacts with the NF-κB/p65 to inhibit its DNA-binding ability to the promoter regions of the major proangiogenesis cytokines critical for tumor progression, including IL6, IL8, and VEGF. In conclusion, we provide compelling evidence that CRIP2 acts as a transcription repressor of the NF-κB-mediated proangiogenic cytokine expression and thus functionally inhibits tumor formation and angiogenesis.

Full Name
cysteine-rich protein 2
References
  • Chang DF. et al., 2003, Dev Cell. 4 (1):107-18.
  • Huber A. et al., 2000, J Biol Chem. 275 (8): 5504-11.
  • Karim MA. et al., 1996, Genomics. 31 (2): 167-76.
  • CRIP2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CRIP2 cDNA ORF Clone in Cloning Vector, Rat RG81186-U
    CRIP2 cDNA ORF Clone, Rat, untagged RG81186-UT
    CRIP2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81186-ACG
    CRIP2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81186-ACGLN
    CRIP2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81186-ANG
    CRIP2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81186-ACR
    CRIP2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81186-ANR
    CRIP2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81186-CF
    CRIP2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81186-NF
    CRIP2 cDNA ORF Clone, Rat, C-His tag RG81186-CH
    CRIP2 cDNA ORF Clone, Rat, N-His tag RG81186-NH
    CRIP2 cDNA ORF Clone, Rat, C-HA tag RG81186-CY
    CRIP2 cDNA ORF Clone, Rat, N-HA tag RG81186-NY
    CRIP2 cDNA ORF Clone, Rat, N-Myc tag RG81186-NM
    CRIP2 qPCR Primer Pairs, Rat RP301142

    CRIP2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CRIP2 cDNA ORF Clone in Cloning Vector, Mouse MG52478-G
    CRIP2 cDNA ORF Clone, Mouse, untagged MG52478-UT
    CRIP2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52478-ACG
    CRIP2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52478-ACGLN
    CRIP2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52478-ANG
    CRIP2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52478-ACR
    CRIP2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52478-ANR
    CRIP2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52478-CF
    CRIP2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52478-NF
    CRIP2 cDNA ORF Clone, Mouse, C-His tag MG52478-CH
    CRIP2 cDNA ORF Clone, Mouse, N-His tag MG52478-NH
    CRIP2 cDNA ORF Clone, Mouse, C-HA tag MG52478-CY
    CRIP2 cDNA ORF Clone, Mouse, N-HA tag MG52478-NY
    CRIP2 cDNA ORF Clone, Mouse, C-Myc tag MG52478-CM
    CRIP2 cDNA ORF Clone, Mouse, N-Myc tag MG52478-NM
    CRIP2 qPCR Primer Pairs, Mouse MP202351
    info info
    添加购物车成功! 添加购物车失败!