CRCP cDNA ORF Clone, Rat, N-HA tag

Cat: RG80628-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CRCP Reagents
CRO Services
Product recommended

All CRCP Reagents
CRCP cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
447 bp
Description
Full length Clone DNA of Rat CGRP receptor component with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CRCP Background Information
Full Name
CGRP receptor component

CRCP cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CRCP cDNA ORF Clone in Cloning Vector, Rat RG80628-U
CRCP cDNA ORF Clone, Rat, untagged RG80628-UT
CRCP cDNA ORF Clone, Rat, C-GFPSpark® tag RG80628-ACG
CRCP Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80628-ACGLN
CRCP cDNA ORF Clone, Rat, N-GFPSpark® tag RG80628-ANG
CRCP cDNA ORF Clone, Rat, C-OFPSpark® tag RG80628-ACR
CRCP cDNA ORF Clone, Rat, N-OFPSpark® tag RG80628-ANR
CRCP cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80628-CF
CRCP cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80628-NF
CRCP cDNA ORF Clone, Rat, C-His tag RG80628-CH
CRCP cDNA ORF Clone, Rat, N-His tag RG80628-NH
CRCP cDNA ORF Clone, Rat, C-HA tag RG80628-CY
CRCP cDNA ORF Clone, Rat, C-Myc tag RG80628-CM
CRCP cDNA ORF Clone, Rat, N-Myc tag RG80628-NM
CRCP qPCR Primer Pairs, Rat RP300592

CRCP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CRCP cDNA ORF Clone in Cloning Vector, Human HG15145-G
CRCP cDNA ORF Clone, Human, untagged HG15145-UT
CRCP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15145-ACGLN
CRCP cDNA ORF Clone, Human, C-GFPSpark® tag HG15145-ACG
CRCP cDNA ORF Clone, Human, N-GFPSpark® tag HG15145-ANG
CRCP cDNA ORF Clone, Human, C-OFPSpark® tag HG15145-ACR
CRCP cDNA ORF Clone, Human, N-OFPSpark® tag HG15145-ANR
CRCP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15145-CF
CRCP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15145-NF
CRCP cDNA ORF Clone, Human, C-His tag HG15145-CH
CRCP cDNA ORF Clone, Human, N-His tag HG15145-NH
CRCP cDNA ORF Clone, Human, C-HA tag HG15145-CY
CRCP cDNA ORF Clone, Human, N-HA tag HG15145-NY
CRCP cDNA ORF Clone, Human, C-Myc tag HG15145-CM
CRCP cDNA ORF Clone, Human, N-Myc tag HG15145-NM
CRCP qPCR Primer Pairs, Human HP103772
info info
添加购物车成功! 添加购物车失败!