CPT1B cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80929-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CPT1B Reagents
CRO Services
Product recommended

All CPT1B Reagents
CPT1B cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
2319 bp
Description
Full length Clone DNA of Rat carnitine palmitoyltransferase 1b, muscle with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPT1B Background Information
Full Name
carnitine palmitoyltransferase 1B (muscle)

CPT1B cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CPT1B cDNA ORF Clone in Cloning Vector, Rat RG80929-U
CPT1B cDNA ORF Clone, Rat, untagged RG80929-UT
CPT1B cDNA ORF Clone, Rat, C-GFPSpark® tag RG80929-ACG
CPT1B Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80929-ACGLN
CPT1B cDNA ORF Clone, Rat, C-OFPSpark® tag RG80929-ACR
CPT1B cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80929-CF
CPT1B cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80929-NF
CPT1B cDNA ORF Clone, Rat, C-His tag RG80929-CH
CPT1B cDNA ORF Clone, Rat, N-His tag RG80929-NH
CPT1B cDNA ORF Clone, Rat, C-HA tag RG80929-CY
CPT1B cDNA ORF Clone, Rat, N-HA tag RG80929-NY
CPT1B cDNA ORF Clone, Rat, C-Myc tag RG80929-CM
CPT1B qPCR Primer Pairs, Rat RP300893

CPT1B cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPT1B cDNA ORF Clone in Cloning Vector, Mouse MG53306-U
CPT1B cDNA ORF Clone, Mouse, untagged MG53306-UT
CPT1B Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53306-ACGLN
CPT1B cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53306-ACG
CPT1B cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53306-ANG
CPT1B cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53306-ACR
CPT1B cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53306-ANR
CPT1B cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53306-CF
CPT1B cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53306-NF
CPT1B cDNA ORF Clone, Mouse, C-His tag MG53306-CH
CPT1B cDNA ORF Clone, Mouse, N-His tag MG53306-NH
CPT1B cDNA ORF Clone, Mouse, C-HA tag MG53306-CY
CPT1B cDNA ORF Clone, Mouse, N-HA tag MG53306-NY
CPT1B cDNA ORF Clone, Mouse, C-Myc tag MG53306-CM
CPT1B cDNA ORF Clone, Mouse, N-Myc tag MG53306-NM

CPT1B cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPT1B cDNA ORF Clone, Human, untagged HG19086-UT
info info
添加购物车成功! 添加购物车失败!