CPN1 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80548-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CPN1 Reagents
CRO Services
Product recommended

All CPN1 Reagents
CPN1 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1374 bp
Description
Full length Clone DNA of Rat carboxypeptidase N, polypeptide 1 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CPN1 Background Information
Full Name
carboxypeptidase N, polypeptide 1

CPN1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CPN1 cDNA ORF Clone in Cloning Vector, Rat RG80548-U
CPN1 cDNA ORF Clone, Rat, untagged RG80548-UT
CPN1 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80548-ACG
CPN1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80548-ACGLN
CPN1 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80548-ACR
CPN1 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80548-CF
CPN1 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80548-NF
CPN1 cDNA ORF Clone, Rat, C-His tag RG80548-CH
CPN1 cDNA ORF Clone, Rat, N-His tag RG80548-NH
CPN1 cDNA ORF Clone, Rat, N-HA tag RG80548-NY
CPN1 cDNA ORF Clone, Rat, C-Myc tag RG80548-CM
CPN1 cDNA ORF Clone, Rat, N-Myc tag RG80548-NM
CPN1 qPCR Primer Pairs, Rat RP300512

CPN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CPN1 cDNA ORF Clone in Cloning Vector, Mouse MG5A0882-U
CPN1 cDNA ORF Clone, Mouse, untagged MG5A0882-UT
CPN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0882-ACG
CPN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A0882-ACGLN
CPN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A0882-ACR
CPN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A0882-CF
CPN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A0882-NF
CPN1 cDNA ORF Clone, Mouse, C-His tag MG5A0882-CH
CPN1 cDNA ORF Clone, Mouse, N-His tag MG5A0882-NH
CPN1 cDNA ORF Clone, Mouse, C-HA tag MG5A0882-CY
CPN1 cDNA ORF Clone, Mouse, N-HA tag MG5A0882-NY
CPN1 cDNA ORF Clone, Mouse, C-Myc tag MG5A0882-CM
CPN1 cDNA ORF Clone, Mouse, N-Myc tag MG5A0882-NM

CPN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CPN1 cDNA ORF Clone in Cloning Vector, Human HG13272-G
CPN1 cDNA ORF Clone, Human, untagged HG13272-UT
CPN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG13272-ACG
CPN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13272-ACGLN
CPN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG13272-ACR
CPN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13272-CF
CPN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13272-NF
CPN1 cDNA ORF Clone, Human, C-His tag HG13272-CH
CPN1 cDNA ORF Clone, Human, N-His tag HG13272-NH
CPN1 cDNA ORF Clone, Human, C-HA tag HG13272-CY
CPN1 cDNA ORF Clone, Human, N-HA tag HG13272-NY
CPN1 cDNA ORF Clone, Human, C-Myc tag HG13272-CM
CPN1 cDNA ORF Clone, Human, N-Myc tag HG13272-NM
CPN1 qPCR Primer Pairs, Human HP101981
info info
添加购物车成功! 添加购物车失败!