Carboxypeptidase B2 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80947-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Carboxypeptidase B2 Reagents
CRO Services
Product recommended

All Carboxypeptidase B2 Reagents
Carboxypeptidase B2 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1269 bp
Description
Full length Clone DNA of Rat carboxypeptidase B2 (plasma) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Carboxypeptidase B2 Background Information

Carboxypeptidase B2, also known as Carboxypeptidase U, Thrombin-activable fibrinolysis inhibitor, Plasma carboxypeptidase B, CPB2, is a secreted protein which belongs to the peptidase M14 family. Carboxypeptidases are enzymes that hydrolyze C-terminal peptide bonds. The carboxypeptidase family includes metallo-, serine, and cysteine carboxypeptidases. According to their substrate specificity, these enzymes are referred to as carboxypeptidase A (cleaving aliphatic residues) or carboxypeptidase B (cleaving basic amino residues). CPB2 is activated by thrombin and acts on carboxypeptidase B substrates. After thrombin activation, the mature protein downregulates fibrinolysis. CPB2 is synthesized by the liver and circulates in the plasma as a plasminogen-bound zymogen. When it is activated by proteolysis at residue Arg92 by the thrombin / thrombomodulin complex. CPB2 cleaves C-terminal arginine or lysine residues from biologically active peptides such as kinins or anaphylatoxins in the circulation thereby regulating their activities. CPB2 exhibits carboxypeptidase activity and activated CPB2 reduces fibrinolysis by removing the fibrin C-terminal residues that are important for the binding and activation of plasminogen.

Full Name
carboxypeptidase B2 (plasma)
References
  • Eaton DL. et al.,1991, J Biol Chem. 266 (32): 21833-8.
  • Boffa MB. et al.,1999, Biochemistry. 38 (20): 6547-58.
  • Liu T. et al., 2005, J. Proteome Res. 4: 2070-80.
  • Valnickova Z. et al., 2006, Biochemistry. 45: 1525-35.
  • Chen R. et al., 2009, J. Proteome Res. 8: 651-61.
  • Carboxypeptidase B2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B2 cDNA ORF Clone in Cloning Vector, Rat RG80947-U
    Carboxypeptidase B2 cDNA ORF Clone, Rat, untagged RG80947-UT
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80947-ACG
    Carboxypeptidase B2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80947-ACGLN
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80947-ACR
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80947-CF
    Carboxypeptidase B2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80947-NF
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-His tag RG80947-CH
    Carboxypeptidase B2 cDNA ORF Clone, Rat, N-His tag RG80947-NH
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-HA tag RG80947-CY
    Carboxypeptidase B2 cDNA ORF Clone, Rat, N-HA tag RG80947-NY
    Carboxypeptidase B2 cDNA ORF Clone, Rat, C-Myc tag RG80947-CM
    Carboxypeptidase B2 qPCR Primer Pairs, Rat RP300911

    Carboxypeptidase B2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B2 cDNA ORF Clone in Cloning Vector, Mouse MG50963-G
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, untagged MG50963-UT
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50963-ACG
    Carboxypeptidase B2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50963-ACGLN
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50963-ACR
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50963-CF
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50963-NF
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-His tag MG50963-CH
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, N-His tag MG50963-NH
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-HA tag MG50963-CY
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, N-HA tag MG50963-NY
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, C-Myc tag MG50963-CM
    Carboxypeptidase B2 cDNA ORF Clone, Mouse, N-Myc tag MG50963-NM
    Carboxypeptidase B2 qPCR Primer Pairs, Mouse MP200932

    Carboxypeptidase B2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Carboxypeptidase B2 qPCR Primer Pairs, Human HP101665
    info info
    添加购物车成功! 添加购物车失败!