Quick Order

Rat Carboxypeptidase A2/CPA2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CPA2 cDNA Clone Product Information
    NCBI RefSeq:NM_001013083.2
    RefSeq ORF Size:1254bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus carboxypeptidase A2 (pancreatic) with N terminal Myc tag.
    Gene Synonym:Cpa2
    Species:Rat
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CPA2 qPCR primers for gene expression analysis, RP300679 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Carboxypeptidase A2 ( CPA2 ) is a secreted pancreatic procarboxy -peptidase, and cleaves the C-terminal amide or ester bond of peptides that have a free C-terminal carboxyl group. The hydrolytic action of CPA2 was identified with a preference towards long substrates with aromatic amino acids in their C-terminal end, particularly tryptophan. CPA2 comprises a signal peptide, a pro region and a mature chain, and can be activated after cleavage of the pro peptide. Three different forms of human pancreatic procarboxypeptidase A have been isolated, and the A1 and A2 forms are always secreted as monomeric proteins with different biochemical properties.

    References
  • Catasus, L. et al., 1995. J. Biol. Chem. 270: 6651-6657.
  • Aloy, P. et al., 1998, Biol. Chem. 379: 149-155.
  • Laethem, RM. et al., 1996, Arch. Biochem. Biophys.332: 8-18.
  • Size / Price
    Catalog: RG80715-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"