COX IV cDNA ORF Clone, Rat, N-HA tag

Cat: RG80759-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COX IV Reagents
CRO Services
Product recommended

All COX IV Reagents
COX IV cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
510 bp
Description
Full length Clone DNA of Rat cytochrome c oxidase subunit IV isoform 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COX IV Background Information
Full Name
cytochrome c oxidase subunit IV isoform 1

COX IV cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COX IV cDNA ORF Clone in Cloning Vector, Rat RG80759-U
COX IV cDNA ORF Clone, Rat, untagged RG80759-UT
COX IV cDNA ORF Clone, Rat, C-GFPSpark® tag RG80759-ACG
COX IV Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80759-ACGLN
COX IV cDNA ORF Clone, Rat, N-GFPSpark® tag RG80759-ANG
COX IV cDNA ORF Clone, Rat, C-OFPSpark® tag RG80759-ACR
COX IV cDNA ORF Clone, Rat, N-OFPSpark® tag RG80759-ANR
COX IV cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80759-CF
COX IV cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80759-NF
COX IV cDNA ORF Clone, Rat, C-His tag RG80759-CH
COX IV cDNA ORF Clone, Rat, N-His tag RG80759-NH
COX IV cDNA ORF Clone, Rat, C-HA tag RG80759-CY
COX IV cDNA ORF Clone, Rat, C-Myc tag RG80759-CM
COX IV cDNA ORF Clone, Rat, N-Myc tag RG80759-NM
COX IV qPCR Primer Pairs, Rat RP300723

COX IV cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COX IV cDNA ORF Clone in Cloning Vector, Human HG14982-G
COX IV cDNA ORF Clone, Human, untagged HG14982-UT
COX IV Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14982-ACGLN
COX IV cDNA ORF Clone, Human, C-GFPSpark® tag HG14982-ACG
COX IV cDNA ORF Clone, Human, N-GFPSpark® tag HG14982-ANG
COX IV cDNA ORF Clone, Human, C-OFPSpark® tag HG14982-ACR
COX IV cDNA ORF Clone, Human, N-OFPSpark® tag HG14982-ANR
COX IV cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14982-CF
COX IV cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14982-NF
COX IV cDNA ORF Clone, Human, C-His tag HG14982-CH
COX IV cDNA ORF Clone, Human, N-His tag HG14982-NH
COX IV cDNA ORF Clone, Human, C-HA tag HG14982-CY
COX IV cDNA ORF Clone, Human, N-HA tag HG14982-NY
COX IV cDNA ORF Clone, Human, C-Myc tag HG14982-CM
COX IV cDNA ORF Clone, Human, N-Myc tag HG14982-NM
COX IV qPCR Primer Pairs, Human HP103610
info info
添加购物车成功! 添加购物车失败!