Quick Order

Rat COQ7 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat COQ7 cDNA Clone Product Information
    NCBI RefSeq:NM_012785.3
    RefSeq ORF Size:654bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus coenzyme Q7 homolog, ubiquinone (yeast) with N terminal Myc tag.
    Gene Synonym:Coq7
    Species:Rat
    Vector:pCMV3-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with COQ7 qPCR primers for gene expression analysis, RP300682 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Ubiquinone biosynthesis protein COQ7 homolog, also known as Coenzyme Q biosynthesis protein 7 homolog, Timing protein clk-1 homolog and COQ7, is a mitochondrion inner membrane and peripheral membrane protein which belongs to the COQ7 family. It is expressed dominantly in heart and skeletal muscle. COQ7 is synthesized as a preprotein that is imported into the mitochondrial matrix, where the sequence is cleaved off and the mature protein becomes loosely associated with the inner membrane. This enzyme is responsible for the hydroxylation of 5-demethoxyubiquinone to 5-hydroxyubiquinone. Human COQ7 protein is mostly helical, and contains an alpha-helical membrane insertion. It has a potential N-glycosylation site, a phosphorylation site for protein kinase C and another for casein kinase II, and three N-myristoylation sites. COQ7 is involved in lifespan determination in ubiquinone-independent manner. It is also involved in ubiquinone biosynthesis. COQ7 is potential central metabolic regulator.

    References
  • Ewbank J.J., et al., 1997, Science. 275: 980-3.
  • Vajo Z., et al., 1999, Mamm. Genome. 10: 1000-4.
  • Wiemann S., et al., 2001, Genome Res. 11: 422-35.
  • Stenmark,P. et al., 2001, J Biol Chem. 276 (36): 33297-300.
  • Martin J., et al., 2004, Nature. 432: 988-94. 
  • Size / Price
    Catalog: RG80718-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"