JAB1/CSN5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81330-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All JAB1/CSN5 Reagents
CRO Services
Product recommended

All JAB1/CSN5 Reagents
JAB1/CSN5 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1005 bp
Description
Full length Clone DNA of Rat COP9 signalosome subunit 5 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

JAB1/CSN5 Background Information
Full Name
COP9 signalosome subunit 5

JAB1/CSN5 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
JAB1/CSN5 cDNA ORF Clone in Cloning Vector, Rhesus CG90742-G
JAB1/CSN5 cDNA ORF Clone, Rhesus, untagged CG90742-UT
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90742-ACG
JAB1/CSN5 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90742-ACGLN
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90742-ANG
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90742-ACR
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90742-ANR
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90742-CF
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90742-NF
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-His tag CG90742-CH
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-His tag CG90742-NH
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-HA tag CG90742-CY
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-HA tag CG90742-NY
JAB1/CSN5 cDNA ORF Clone, Rhesus, C-Myc tag CG90742-CM
JAB1/CSN5 cDNA ORF Clone, Rhesus, N-Myc tag CG90742-NM

JAB1/CSN5 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
JAB1/CSN5 cDNA ORF Clone in Cloning Vector, Rat RG81330-U
JAB1/CSN5 cDNA ORF Clone, Rat, untagged RG81330-UT
JAB1/CSN5 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81330-ACGLN
JAB1/CSN5 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81330-ACG
JAB1/CSN5 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81330-ANG
JAB1/CSN5 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81330-ACR
JAB1/CSN5 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81330-ANR
JAB1/CSN5 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81330-NF
JAB1/CSN5 cDNA ORF Clone, Rat, C-His tag RG81330-CH
JAB1/CSN5 cDNA ORF Clone, Rat, N-His tag RG81330-NH
JAB1/CSN5 cDNA ORF Clone, Rat, C-HA tag RG81330-CY
JAB1/CSN5 cDNA ORF Clone, Rat, N-HA tag RG81330-NY
JAB1/CSN5 cDNA ORF Clone, Rat, C-Myc tag RG81330-CM
JAB1/CSN5 cDNA ORF Clone, Rat, N-Myc tag RG81330-NM
JAB1/CSN5 qPCR Primer Pairs, Rat RP301275

JAB1/CSN5 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
JAB1/CSN5 cDNA ORF Clone in Cloning Vector, Human HG17128-U
JAB1/CSN5 cDNA ORF Clone, Human, untagged HG17128-UT
JAB1/CSN5 cDNA ORF Clone, Human, C-GFPSpark® tag HG17128-ACG
JAB1/CSN5 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17128-ACGLN
JAB1/CSN5 cDNA ORF Clone, Human, N-GFPSpark® tag HG17128-ANG
JAB1/CSN5 cDNA ORF Clone, Human, C-OFPSpark® tag HG17128-ACR
JAB1/CSN5 cDNA ORF Clone, Human, N-OFPSpark® tag HG17128-ANR
JAB1/CSN5 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17128-CF
JAB1/CSN5 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17128-NF
JAB1/CSN5 cDNA ORF Clone, Human, C-His tag HG17128-CH
JAB1/CSN5 cDNA ORF Clone, Human, N-His tag HG17128-NH
JAB1/CSN5 cDNA ORF Clone, Human, C-HA tag HG17128-CY
JAB1/CSN5 cDNA ORF Clone, Human, N-HA tag HG17128-NY
JAB1/CSN5 cDNA ORF Clone, Human, C-Myc tag HG17128-CM
JAB1/CSN5 cDNA ORF Clone, Human, N-Myc tag HG17128-NM
info info
添加购物车成功! 添加购物车失败!