COPS3 cDNA ORF Clone, Rat, N-Myc tag

Cat: RG80995-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All COPS3 Reagents
CRO Services
Product recommended

All COPS3 Reagents
COPS3 cDNA ORF Clone, Rat, N-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1272 bp
Description
Full length Clone DNA of Rat COP9 signalosome subunit 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COPS3 Background Information
Full Name
COP9 signalosome subunit 3

COPS3 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
COPS3 cDNA ORF Clone in Cloning Vector, Rat RG80995-U
COPS3 cDNA ORF Clone, Rat, untagged RG80995-UT
COPS3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80995-ACG
COPS3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80995-ACGLN
COPS3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80995-ANG
COPS3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80995-ACR
COPS3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80995-ANR
COPS3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80995-CF
COPS3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80995-NF
COPS3 cDNA ORF Clone, Rat, C-His tag RG80995-CH
COPS3 cDNA ORF Clone, Rat, N-His tag RG80995-NH
COPS3 cDNA ORF Clone, Rat, C-HA tag RG80995-CY
COPS3 cDNA ORF Clone, Rat, N-HA tag RG80995-NY
COPS3 cDNA ORF Clone, Rat, C-Myc tag RG80995-CM
COPS3 qPCR Primer Pairs, Rat RP300959

COPS3 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
COPS3 cDNA ORF Clone in Cloning Vector, Mouse MG52542-G
COPS3 cDNA ORF Clone, Mouse, untagged MG52542-UT
COPS3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52542-ACG
COPS3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52542-ACGLN
COPS3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52542-ANG
COPS3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52542-ACR
COPS3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52542-ANR
COPS3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52542-CF
COPS3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52542-NF
COPS3 cDNA ORF Clone, Mouse, C-His tag MG52542-CH
COPS3 cDNA ORF Clone, Mouse, N-His tag MG52542-NH
COPS3 cDNA ORF Clone, Mouse, C-HA tag MG52542-CY
COPS3 cDNA ORF Clone, Mouse, N-HA tag MG52542-NY
COPS3 cDNA ORF Clone, Mouse, C-Myc tag MG52542-CM
COPS3 cDNA ORF Clone, Mouse, N-Myc tag MG52542-NM
COPS3 qPCR Primer Pairs, Mouse MP202415

COPS3 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
COPS3 cDNA ORF Clone in Cloning Vector, Human HG19034-U
COPS3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG19034-ACGLN
info info
添加购物车成功! 添加购物车失败!