TRIP15/COPS2 cDNA ORF Clone, Rat, C-His tag

Cat: RG81120-CH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All TRIP15/COPS2 Reagents
CRO Services
Product recommended

All TRIP15/COPS2 Reagents
TRIP15/COPS2 cDNA ORF Clone, Rat, C-His tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1332 bp
Description
Full length Clone DNA of Rat COP9 signalosome subunit 2 with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

TRIP15/COPS2 Background Information
Full Name
COP9 signalosome subunit 2

TRIP15/COPS2 cDNA ORF Clone, Rabbit, Related Products

Product Name Catalog#(PDF)
TRIP15/COPS2 cDNA ORF Clone in Cloning Vector, Rabbit TG65094-G
TRIP15/COPS2 cDNA ORF Clone, Rabbit, untagged TG65094-UT
TRIP15/COPS2 Lentiviral cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65094-ACGLN
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-GFPSpark® tag TG65094-ACG
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-GFPSpark® tag TG65094-ANG
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-OFPSpark® tag TG65094-ACR
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-OFPSpark® tag TG65094-ANR
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-DDK (Flag®) tag TG65094-CF
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-DDK (Flag®) tag TG65094-NF
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-His tag TG65094-CH
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-His tag TG65094-NH
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-HA tag TG65094-CY
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-HA tag TG65094-NY
TRIP15/COPS2 cDNA ORF Clone, Rabbit, C-Myc tag TG65094-CM
TRIP15/COPS2 cDNA ORF Clone, Rabbit, N-Myc tag TG65094-NM

TRIP15/COPS2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
TRIP15/COPS2 cDNA ORF Clone in Cloning Vector, Rat RG81120-U
TRIP15/COPS2 cDNA ORF Clone, Rat, untagged RG81120-UT
TRIP15/COPS2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81120-ACG
TRIP15/COPS2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81120-ACGLN
TRIP15/COPS2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81120-ANG
TRIP15/COPS2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81120-ACR
TRIP15/COPS2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81120-ANR
TRIP15/COPS2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81120-CF
TRIP15/COPS2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81120-NF
TRIP15/COPS2 cDNA ORF Clone, Rat, N-His tag RG81120-NH
TRIP15/COPS2 cDNA ORF Clone, Rat, C-HA tag RG81120-CY
TRIP15/COPS2 cDNA ORF Clone, Rat, N-HA tag RG81120-NY
TRIP15/COPS2 cDNA ORF Clone, Rat, C-Myc tag RG81120-CM
TRIP15/COPS2 cDNA ORF Clone, Rat, N-Myc tag RG81120-NM
TRIP15/COPS2 qPCR Primer Pairs, Rat RP301077

TRIP15/COPS2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
TRIP15/COPS2 cDNA ORF Clone in Cloning Vector, Human HG13676-G
TRIP15/COPS2 cDNA ORF Clone, Human, untagged HG13676-UT
TRIP15/COPS2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13676-ACGLN
TRIP15/COPS2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13676-ACG
TRIP15/COPS2 cDNA ORF Clone, Human, N-GFPSpark® tag HG13676-ANG
TRIP15/COPS2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13676-ACR
TRIP15/COPS2 cDNA ORF Clone, Human, N-OFPSpark® tag HG13676-ANR
TRIP15/COPS2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13676-CF
TRIP15/COPS2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13676-NF
TRIP15/COPS2 cDNA ORF Clone, Human, C-His tag HG13676-CH
TRIP15/COPS2 cDNA ORF Clone, Human, N-His tag HG13676-NH
TRIP15/COPS2 cDNA ORF Clone, Human, C-HA tag HG13676-CY
TRIP15/COPS2 cDNA ORF Clone, Human, N-HA tag HG13676-NY
TRIP15/COPS2 cDNA ORF Clone, Human, C-Myc tag HG13676-CM
TRIP15/COPS2 cDNA ORF Clone, Human, N-Myc tag HG13676-NM
TRIP15/COPS2 qPCR Primer Pairs, Human HP102355
info info
添加购物车成功! 添加购物车失败!