COLEC10 cDNA ORF Clone, Rat, C-Myc tag

Cat: RG80217-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All COLEC10 Reagents
CRO Services
Product recommended

All COLEC10 Reagents
COLEC10 cDNA ORF Clone, Rat, C-Myc tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
834 bp
Description
Full length Clone DNA of Rat collectin sub-family member 10 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

COLEC10 Background Information

COLEC10 is a member of the C-lectin family. Members of this family possess collagen-like sequences and carbohydrate recognition domains. The other members of this family are secreted proteins and bind to carbohydrate antigens on microorganisms facilitating their recognition and removal. This gene product is a cytosolic protein, a characteristic that suggests that it may have different biological functions than other C-lectins.

Full Name
collectin sub-family member 10 (C-type lectin)
References
  • Ohtani K., et al.,(1999), Molecular cloning of a novel human collectin from liver (CL-L1). J. Biol. Chem. 274:13681-13689.
  • Clark H.F., et al., (2003), The secreted protein discovery initiative (SPDI), a large-scale effort to identify novel human secreted and transmembrane proteins: a bioinformatics assessment.Genome Res. 13:2265-2270.
  • Ota T., et al.,(2004), Complete sequencing and characterization of 21,243 full-length human cDNAs.Nat. Genet. 36:40-45.
  • COLEC10 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    COLEC10 cDNA ORF Clone in Cloning Vector, Rhesus CG90146-G
    COLEC10 cDNA ORF Clone, Rhesus, untagged CG90146-UT
    COLEC10 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90146-ACG
    COLEC10 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90146-ACGLN
    COLEC10 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90146-ACR
    COLEC10 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90146-CF
    COLEC10 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90146-NF
    COLEC10 cDNA ORF Clone, Rhesus, C-His tag CG90146-CH
    COLEC10 cDNA ORF Clone, Rhesus, N-His tag CG90146-NH
    COLEC10 cDNA ORF Clone, Rhesus, C-HA tag CG90146-CY
    COLEC10 cDNA ORF Clone, Rhesus, N-HA tag CG90146-NY
    COLEC10 cDNA ORF Clone, Rhesus, C-Myc tag CG90146-CM
    COLEC10 cDNA ORF Clone, Rhesus, N-Myc tag CG90146-NM

    COLEC10 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    COLEC10 cDNA ORF Clone in Cloning Vector, Rat RG80217-G
    COLEC10 cDNA ORF Clone, Rat, untagged RG80217-UT
    COLEC10 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80217-ACGLN
    COLEC10 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80217-ACG
    COLEC10 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80217-ACR
    COLEC10 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80217-CF
    COLEC10 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80217-NF
    COLEC10 cDNA ORF Clone, Rat, C-His tag RG80217-CH
    COLEC10 cDNA ORF Clone, Rat, N-His tag RG80217-NH
    COLEC10 cDNA ORF Clone, Rat, C-HA tag RG80217-CY
    COLEC10 cDNA ORF Clone, Rat, N-HA tag RG80217-NY
    COLEC10 cDNA ORF Clone, Rat, N-Myc tag RG80217-NM
    COLEC10 qPCR Primer Pairs, Rat RP300208

    COLEC10 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    COLEC10 cDNA ORF Clone in Cloning Vector, Mouse MG50189-M
    COLEC10 cDNA ORF Clone, Mouse, untagged MG50189-UT
    COLEC10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50189-ACGLN
    COLEC10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50189-ACG
    COLEC10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50189-ACR
    COLEC10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50189-CF
    COLEC10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50189-NF
    COLEC10 cDNA ORF Clone, Mouse, C-His tag MG50189-CH
    COLEC10 cDNA ORF Clone, Mouse, N-His tag MG50189-NH
    COLEC10 cDNA ORF Clone, Mouse, C-HA tag MG50189-CY
    COLEC10 cDNA ORF Clone, Mouse, N-HA tag MG50189-NY
    COLEC10 cDNA ORF Clone, Mouse, C-Myc tag MG50189-CM
    COLEC10 cDNA ORF Clone, Mouse, N-Myc tag MG50189-NM
    COLEC10 qPCR Primer Pairs, Mouse MP200219
    info info
    添加购物车成功! 添加购物车失败!