Quick Order

Text Size:AAA

Rat CNTN5 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Rat CNTN5 cDNA Clone Product Information
NCBI RefSeq:NM_053746.1
RefSeq ORF Size:3300bp
cDNA Description:Full length Clone DNA of Rattus norvegicus contactin 5 with N terminal His tag.
Gene Synonym:Nb-2, Cntn5
Species:Rat
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed mainly in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-5, also known as NB-2, is one of the neural recognition molecules in the contactin subgroup. Contactin-5 is expressed in brain and kidney and at very low level in placenta. In brain, Contactin-5 is highly expressed in the occipital lobe, amygdala, cerebral cortex, frontal lobe, thalamus and temporal lobe. Mice deficient in the Contactin-5 gene exhibit aberrant responses to acoustic stimuli. Contactin-5 may play a role in maturation of glutamatergic synapses in the brainstem during the final stages of auditory development. Contactin-5 gene may contribute to human neurological disorders.

References
  • Kamei Y, et al. (2000) Human NB-2 of the contactin subgroup molecules: chromosomal localization of the gene (CNTN5) and distinct expression pattern from other subgroup members. Genomics 69(1):113-9.
  • Ogawa J, et al. (2001) Neural recognition molecule NB-2 of the contactin/F3 subgroup in rat: Specificity in neurite outgrowth-promoting activity and restricted expression in the brain regions. J Neurosci Res. 65(2):100-10.
  • Li H, et al. (2003) Aberrant responses to acoustic stimuli in mice deficient for neural recognition molecule NB-2. Eur J Neurosci. 17(5):929-36.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Toyoshima M, et al. (2009) Preferential localization of neural cell recognition molecule NB-2 in developing glutamatergic neurons in the rat auditory brainstem. J Comp Neurol. 513(4):349-62.
  • Size / Price
    Catalog: RG80409-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"