Contactin 3 cDNA ORF Clone, Rat, untagged

Cat: RG80316-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Contactin 3 Reagents
CRO Services
Product recommended

All Contactin 3 Reagents
Contactin 3 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
3087 bp
Description
Full length Clone DNA of Rat contactin 3 (plasmacytoma associated).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Contactin 3 Background Information

Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-3, also known as CNTN3 ( BIG-1 in rat and PANG in mouse ), is a GPI-linked glycoprotein that is expressed on cerebellar Purkinje cells, amygdaloid and thalamic neurons and olfactory granule cells. In the brain, Contactin-3 is expressed in frontal lobe, occipital lobe, cerebellum and amygdala. Contactin-3 contains 4 fibronectin type-III domains and 6 Ig-like C2-type (immunoglobulin-like) domains. Human Contactin-3 shares 92% aa identity with mouse Contactin-3.The exact function of Contactin-3 is unclear. Contactin-3 may mediate cell-cell interaction and may promote neurite outgrowth.

Full Name
contactin 3 (plasmacytoma associated)
References
  • Yoshihara Y, et al. (1994) BIG-1: a new TAG-1/F3-related member of the immunoglobulin superfamily with neurite outgrowth-promoting activity. Neuron 13(2):415-26.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Yoshihara Y, et al. (1995) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. Journal of neurobiology 28(1):51-69.
  • Shimoda Y, et al. (2009) Contactins: Emerging key roles in the development and function of the nervous system. Cell adhesion & migration 3(1):64-70.
  • Contactin 3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Contactin 3 cDNA ORF Clone in Cloning Vector, Rat RG80316-G
    Contactin 3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80316-ACGLN
    Contactin 3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80316-ACG
    Contactin 3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80316-ACR
    Contactin 3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80316-CF
    Contactin 3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80316-NF
    Contactin 3 cDNA ORF Clone, Rat, C-His tag RG80316-CH
    Contactin 3 cDNA ORF Clone, Rat, N-His tag RG80316-NH
    Contactin 3 cDNA ORF Clone, Rat, C-HA tag RG80316-CY
    Contactin 3 cDNA ORF Clone, Rat, N-HA tag RG80316-NY
    Contactin 3 cDNA ORF Clone, Rat, C-Myc tag RG80316-CM
    Contactin 3 cDNA ORF Clone, Rat, N-Myc tag RG80316-NM
    Contactin 3 qPCR Primer Pairs, Rat RP300289

    Contactin 3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Contactin 3 cDNA ORF Clone in Cloning Vector, Mouse MG51007-G
    Contactin 3 cDNA ORF Clone, Mouse, untagged MG51007-UT
    Contactin 3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51007-ACGLN
    Contactin 3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51007-ACG
    Contactin 3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51007-ACR
    Contactin 3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51007-CF
    Contactin 3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51007-NF
    Contactin 3 cDNA ORF Clone, Mouse, C-His tag MG51007-CH
    Contactin 3 cDNA ORF Clone, Mouse, N-His tag MG51007-NH
    Contactin 3 cDNA ORF Clone, Mouse, C-HA tag MG51007-CY
    Contactin 3 cDNA ORF Clone, Mouse, N-HA tag MG51007-NY
    Contactin 3 cDNA ORF Clone, Mouse, C-Myc tag MG51007-CM
    Contactin 3 cDNA ORF Clone, Mouse, N-Myc tag MG51007-NM
    Contactin 3 qPCR Primer Pairs, Mouse MP200967

    Contactin 3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Contactin 3 cDNA ORF Clone in Cloning Vector, Human HG10174-M
    Contactin 3 cDNA ORF Clone, Human, untagged HG10174-UT
    Contactin 3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10174-ACGLN
    Contactin 3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10174-ACG
    Contactin 3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10174-ACR
    Contactin 3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10174-CF
    Contactin 3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10174-NF
    Contactin 3 cDNA ORF Clone, Human, C-His tag HG10174-CH
    Contactin 3 cDNA ORF Clone, Human, N-His tag HG10174-NH
    Contactin 3 cDNA ORF Clone, Human, C-HA tag HG10174-CY
    Contactin 3 cDNA ORF Clone, Human, N-HA tag HG10174-NY
    Contactin 3 cDNA ORF Clone, Human, C-Myc tag HG10174-CM
    Contactin 3 cDNA ORF Clone, Human, N-Myc tag HG10174-NM
    Contactin 3 qPCR Primer Pairs, Human HP100242
    info info
    添加购物车成功! 添加购物车失败!