Text Size:AAA

Rat Contactin 2/CNTN2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CNTN2 cDNA Clone Product Information
    NCBI RefSeq:NM_012884.1
    RefSeq ORF Size:3123bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus contactin 2 (axonal) with N terminal Myc tag.
    Gene Synonym:Tax, TAG1, TAG-1, TAG-564, Cntn2
    Species:Rat
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CNTN2 qPCR primers for gene expression analysis, RP300384 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Contactins are a subgroup of molecules belonging to the immunoglobulin superfamily that are expressed exclusively in the nervous system. The subgroup consists of six members: Contactin-1, Contactin-2(TAG-1), Contactin-3(BIG-1), BIG-2, Contactin-5(NB-2) and NB-3. Since their identification in the late 1980s, Contactin-1 and Contactin-2 have been studied extensively. Axonal expression and the neurite extension activity of Contactin-1 and Contactin-2 attracted researchers to study the function of these molecules in axon guidance during development. Contactin-1 and Contactin-2 have come to be known as the principal molecules in the function and maintenance of myelinated neurons. In contrast, the function of the other four members of this subgroup remained unknown until recently. Contactin-2, also known as CNTN2, is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. The human, rat, and chicken Contactin-2 are alternatively known as TAX1 (transiently-expressed axonal glycoprotein), TAG1 (transient axonal glycoprotein), and axonin-1, respectively. Human Contactin-2 shares approximately 91% and 75% amino acid sequence identity with rat and chicken Contactin-2, respectively. Contactin-2 is expressed by a subset of neuronal populations in the developing central nervous system (CNS) and peripheral nervous system (PNS). Contactin-2 is also expressed by oligodendrocytes and Schwann cells, which are myelinating glial cells of the CNS and PNS, respectively. Contactin-2 may play a role in the formation of axon connections in the developing nervous system. Contactin-2 is also involved in glial tumorigenesis and may provide a potential target for therapeutic intervention. During embryonic development, Contactin-2 interacts either in a homophilic, or heterophilic fashion with various transmembrane proteins.

    References
  • Kyriakopoulou K, et al. (2002) A combination of chain and neurophilic migration involving the adhesion molecule TAG-1 in the caudal medulla. Development 129 (2):287-96.
  • Traka M, et al. (2002) The neuronal adhesion protein TAG-1 is expressed by Schwann cells and oligodendrocytes and is localized to the juxtaparanodal region of myelinated fibers. J Neurosci. 22(8):3016-24.
  • Traka M, et al. (2003) Association of TAG-1 with Caspr2 is essential for the molecular organization of juxtaparanodal regions of myelinated fibers. J Cell Biol. 162(6):1161-72.
  • Soares S, et al. (2005) Neuronal and glial expression of the adhesion molecule TAG-1 is regulated after peripheral nerve lesion or central neurodegeneration of adult nervous system. Eur J Neurosci. 21(5):1169-80.
  • Derfuss T, et al. (2009) Contactin-2/TAG-1-directed autoimmunity is identified in multiple sclerosis patients and mediates gray matter pathology in animals. Proc Natl Acad Sci U S A. 106(20):8302-7.
  • Size / Price
    Catalog: RG80420-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"