CNTFR cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG80019-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CNTFR Reagents
CRO Services
Product recommended

All CNTFR Reagents
CNTFR cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1119 bp
Description
Full length Clone DNA of Rat ciliary neurotrophic factor receptor with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNTFR Background Information

Ciliary neurotrophic factor(CNTF) is a member of the cytokine family. It is a polypeptide hormone that have functions in promoting neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. It's actions appear to be restricted to the nervous system. Ciliary neurotrophic factor(CNTF) has biological effects through the activation of a multi-subunit receptor complex, consisting of an extracelluar CNTF binding subunit(CNTFα) and two transmembrane signal transduction proteins: glycoprotein gp130 and LIF receptor. CNTF is considered as a potent survival factor of neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. CNTF is also a survival factor for neurons of the peripheral sensory sympathetic, and ciliary ganglia. It has been reported that CNTF could be an agent that has therapeutic potential and possibly induces differentiation of large multipolar ganglionic phenotype in a subset of progenitors.

Full Name
ciliary neurotrophic factor receptor
References
  • Dutt K, et al. (2010) Ciliary neurotrophic factor: a survival and differentiation inducer in human retinal progenitors. In Vitro Cell Dev Biol Anim. 46 (7) : 635-46.
  • Lam A, et al. ( 1991) Sequence and structural organization of the human gene encoding ciliary neurotrophic factor. Gene 102 (2) : 271-6.
  • Bazan JF. ( 1991) Neuropoietic cytokines in the hematopoietic fold. Neuron 7 (2) : 197-208.
  • CNTFR cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CNTFR cDNA ORF Clone in Cloning Vector, Rat RG80019-M
    CNTFR cDNA ORF Clone, Rat, untagged RG80019-UT
    CNTFR cDNA ORF Clone, Rat, C-GFPSpark® tag RG80019-ACG
    CNTFR Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80019-ACGLN
    CNTFR cDNA ORF Clone, Rat, C-OFPSpark® tag RG80019-ACR
    CNTFR cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80019-NF
    CNTFR cDNA ORF Clone, Rat, C-His tag RG80019-CH
    CNTFR cDNA ORF Clone, Rat, N-His tag RG80019-NH
    CNTFR cDNA ORF Clone, Rat, C-HA tag RG80019-CY
    CNTFR cDNA ORF Clone, Rat, N-HA tag RG80019-NY
    CNTFR cDNA ORF Clone, Rat, C-Myc tag RG80019-CM
    CNTFR cDNA ORF Clone, Rat, N-Myc tag RG80019-NM
    CNTFR qPCR Primer Pairs, Rat RP300018

    CNTFR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CNTFR cDNA ORF Clone, Mouse, untagged MG58994-UT
    CNTFR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58994-ACGLN
    CNTFR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG58994-ACG
    CNTFR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG58994-ACR
    CNTFR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG58994-CF
    CNTFR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG58994-NF
    CNTFR cDNA ORF Clone, Mouse, C-His tag MG58994-CH
    CNTFR cDNA ORF Clone, Mouse, N-His tag MG58994-NH
    CNTFR cDNA ORF Clone, Mouse, C-HA tag MG58994-CY
    CNTFR cDNA ORF Clone, Mouse, N-HA tag MG58994-NY
    CNTFR cDNA ORF Clone, Mouse, C-Myc tag MG58994-CM
    CNTFR cDNA ORF Clone, Mouse, N-Myc tag MG58994-NM

    CNTFR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    CNTFR cDNA ORF Clone in Cloning Vector, Human HG11012-M
    CNTFR cDNA ORF Clone, Human, untagged HG11012-UT
    CNTFR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11012-ACGLN
    CNTFR cDNA ORF Clone, Human, C-GFPSpark® tag HG11012-ACG
    CNTFR cDNA ORF Clone, Human, C-OFPSpark® tag HG11012-ACR
    CNTFR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11012-CF
    CNTFR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11012-NF
    CNTFR cDNA ORF Clone, Human, C-His tag HG11012-CH
    CNTFR cDNA ORF Clone, Human, N-His tag HG11012-NH
    CNTFR cDNA ORF Clone, Human, C-HA tag HG11012-CY
    CNTFR cDNA ORF Clone, Human, N-HA tag HG11012-NY
    CNTFR cDNA ORF Clone, Human, C-Myc tag HG11012-CM
    CNTFR cDNA ORF Clone, Human, N-Myc tag HG11012-NM
    CNTFR qPCR Primer Pairs, Human HP100974
    info info
    添加购物车成功! 添加购物车失败!