After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CNTFR Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat CNTFR cDNA Clone Product Information
NCBI RefSeq:NM_001003929.1
RefSeq ORF Size:1119bp
cDNA Description:Full length Clone DNA of Rattus norvegicus ciliary neurotrophic factor receptor with C terminal Flag tag.
Gene Synonym:Cntfr
Species:Rat
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

Ciliary neurotrophic factor(CNTF) is a member of the cytokine family. It is a polypeptide hormone that have functions in promoting neurotransmitter synthesis and neurite outgrowth in certain neuronal populations. It's actions appear to be restricted to the nervous system. Ciliary neurotrophic factor(CNTF) has biological effects through the activation of a multi-subunit receptor complex, consisting of an extracelluar CNTF binding subunit(CNTFα) and two transmembrane signal transduction proteins: glycoprotein gp130 and LIF receptor. CNTF is considered as a potent survival factor of neurons and oligodendrocytes and may be relevant in reducing tissue destruction during inflammatory attacks. CNTF is also a survival factor for neurons of the peripheral sensory sympathetic, and ciliary ganglia. It has been reported that CNTF could be an agent that has therapeutic potential and possibly induces differentiation of large multipolar ganglionic phenotype in a subset of progenitors.

References
  • Dutt K, et al. (2010) Ciliary neurotrophic factor: a survival and differentiation inducer in human retinal progenitors. In Vitro Cell Dev Biol Anim. 46 (7) : 635-46.
  • Lam A, et al. ( 1991) Sequence and structural organization of the human gene encoding ciliary neurotrophic factor. Gene 102 (2) : 271-6.
  • Bazan JF. ( 1991) Neuropoietic cytokines in the hematopoietic fold. Neuron 7 (2) : 197-208.
  • Size / Price
    Catalog: RG80019-CF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"