CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-HA tag

Cat: RG80640-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CNPPD1/C2orf24 Reagents
CRO Services
Product recommended

All CNPPD1/C2orf24 Reagents
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1227 bp
Description
Full length Clone DNA of Rat cyclin Pas1/PHO80 domain containing 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CNPPD1/C2orf24 Background Information
Full Name
cyclin Pas1/PHO80 domain containing 1

CNPPD1/C2orf24 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CNPPD1/C2orf24 cDNA ORF Clone in Cloning Vector, Rat RG80640-U
CNPPD1/C2orf24 cDNA ORF Clone, Rat, untagged RG80640-UT
CNPPD1/C2orf24 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80640-ACGLN
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80640-ACG
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80640-ANG
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80640-ACR
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80640-ANR
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80640-CF
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80640-NF
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-His tag RG80640-CH
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-His tag RG80640-NH
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-HA tag RG80640-CY
CNPPD1/C2orf24 cDNA ORF Clone, Rat, C-Myc tag RG80640-CM
CNPPD1/C2orf24 cDNA ORF Clone, Rat, N-Myc tag RG80640-NM
CNPPD1/C2orf24 qPCR Primer Pairs, Rat RP300604

CNPPD1/C2orf24 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CNPPD1/C2orf24 cDNA ORF Clone in Cloning Vector, Mouse MG53218-G
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, untagged MG53218-UT
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53218-ACG
CNPPD1/C2orf24 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53218-ACGLN
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53218-ACR
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53218-CF
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53218-NF
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-His tag MG53218-CH
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, N-His tag MG53218-NH
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-HA tag MG53218-CY
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, N-HA tag MG53218-NY
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, C-Myc tag MG53218-CM
CNPPD1/C2orf24 cDNA ORF Clone, Mouse, N-Myc tag MG53218-NM

CNPPD1/C2orf24 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CNPPD1/C2orf24 cDNA ORF Clone in Cloning Vector, Human HG16574-U
CNPPD1/C2orf24 cDNA ORF Clone, Human, untagged HG16574-UT
CNPPD1/C2orf24 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16574-ACGLN
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-GFPSpark® tag HG16574-ACG
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-OFPSpark® tag HG16574-ACR
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16574-CF
CNPPD1/C2orf24 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16574-NF
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-His tag HG16574-CH
CNPPD1/C2orf24 cDNA ORF Clone, Human, N-His tag HG16574-NH
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-HA tag HG16574-CY
CNPPD1/C2orf24 cDNA ORF Clone, Human, N-HA tag HG16574-NY
CNPPD1/C2orf24 cDNA ORF Clone, Human, C-Myc tag HG16574-CM
CNPPD1/C2orf24 cDNA ORF Clone, Human, N-Myc tag HG16574-NM
info info
添加购物车成功! 添加购物车失败!