CLPX cDNA ORF Clone, Rat, untagged

Cat: RG81144-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLPX Reagents
CRO Services
Product recommended

All CLPX Reagents
CLPX cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
1902 bp
Description
Full length Clone DNA of Rat caseinolytic mitochondrial matrix peptidase chaperone subunit.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLPX Background Information
Full Name
caseinolytic mitochondrial matrix peptidase chaperone subunit

CLPX cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
CLPX cDNA ORF Clone in Cloning Vector, Rat RG81144-U
CLPX cDNA ORF Clone, Rat, C-GFPSpark® tag RG81144-ACG
CLPX Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81144-ACGLN
CLPX cDNA ORF Clone, Rat, N-GFPSpark® tag RG81144-ANG
CLPX cDNA ORF Clone, Rat, C-OFPSpark® tag RG81144-ACR
CLPX cDNA ORF Clone, Rat, N-OFPSpark® tag RG81144-ANR
CLPX cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81144-CF
CLPX cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81144-NF
CLPX cDNA ORF Clone, Rat, C-His tag RG81144-CH
CLPX cDNA ORF Clone, Rat, N-His tag RG81144-NH
CLPX cDNA ORF Clone, Rat, C-HA tag RG81144-CY
CLPX cDNA ORF Clone, Rat, N-HA tag RG81144-NY
CLPX cDNA ORF Clone, Rat, C-Myc tag RG81144-CM
CLPX cDNA ORF Clone, Rat, N-Myc tag RG81144-NM
CLPX qPCR Primer Pairs, Rat RP301100

CLPX cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
CLPX cDNA ORF Clone in Cloning Vector, Mouse MG5A2534-U
CLPX cDNA ORF Clone, Mouse, untagged MG5A2534-UT
CLPX cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2534-ACG
CLPX Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A2534-ACGLN
CLPX cDNA ORF Clone, Mouse, N-GFPSpark® tag MG5A2534-ANG
CLPX cDNA ORF Clone, Mouse, C-OFPSpark® tag MG5A2534-ACR
CLPX cDNA ORF Clone, Mouse, N-OFPSpark® tag MG5A2534-ANR
CLPX cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A2534-CF
CLPX cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG5A2534-NF
CLPX cDNA ORF Clone, Mouse, C-His tag MG5A2534-CH
CLPX cDNA ORF Clone, Mouse, N-His tag MG5A2534-NH
CLPX cDNA ORF Clone, Mouse, C-HA tag MG5A2534-CY
CLPX cDNA ORF Clone, Mouse, N-HA tag MG5A2534-NY
CLPX cDNA ORF Clone, Mouse, C-Myc tag MG5A2534-CM
CLPX cDNA ORF Clone, Mouse, N-Myc tag MG5A2534-NM

CLPX cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
CLPX cDNA ORF Clone, Human, untagged HG21380-UT
info info
添加购物车成功! 添加购物车失败!