Quick Order

Rat CLEC4B2 / mDCAR1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Rat CLEC4B2 cDNA Clone Product Information
NCBI RefSeq:NM_001005896.1
RefSeq ORF Size:627bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2.
Gene Synonym:Aplra1, Clec4b2
Species:Rat
Vector:pCMV3-untagged
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Product nameProduct name
Background

Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

References
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catalog: RG80265-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"