Quick Order

Rat CLEC4B2 / mDCAR1 Gene ORF cDNA clone expression plasmid, C-His tag

    DatasheetReviewsRelated ProductsProtocols
    Rat CLEC4B2 cDNA Clone Product Information
    NCBI RefSeq:NM_001005896.1
    RefSeq ORF Size:627bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member B2 with C terminal His tag.
    Gene Synonym:Aplra1, Clec4b2
    Species:Rat
    Vector:pCMV3-C-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC4B2 qPCR primers for gene expression analysis, RP300249 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

    Product nameProduct name
    Background

    Clec4b2, also known as mDCAR1, is a member of the DCIR/DCAR family. Expression of Clec4b2 was strongly tissue dependent. Clec4b2 expression on DCs was restricted to the CD8(+) DC subset in spleen and thymus and on subpopulations of CD11b(+) myeloid cells in bone marrow and spleen, whereas the molecule was not detectable on both cell types in lymph nodes and peripheral blood. Clec4b2 is a functional receptor on cells of the immune system and provides further insights into the regulation of immune responses by CLRs.

    References
  • Katayama S. et al., 2005, Science. 309 (5740): 1564-6.
  • Kaden SA. et al., 2009, J Immunol. 183 (8): 5069-78.
  • Skarnes WC. et al., 2011, Nature. 474 (7351): 337-42.
  • Size / Price
    Catalog: RG80265-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"