CLEC4A3 cDNA ORF Clone, Rat, C-HA tag

Cat: RG80392-CY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All CLEC4A3 Reagents
CRO Services
Product recommended

All CLEC4A3 Reagents
CLEC4A3 cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
714 bp
Description
Full length Clone DNA of Rat C-type lectin domain family 4, member A3 with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CLEC4A3 cDNA ORF Clone, Rat, C-HA tag Alternative Names
CLEC4A3 cDNA ORF Clone, Rat
CLEC4A3 Background Information

CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.

The C-type lectin has a three-dimensional fold, the CRD, in which calcium ions contribute to the lectin's ability to recognize and bind carbohydrates. In the immune system, carbohydrate recognition contributes to the ability of immune cells to move from one area of the body to another. It also allows immune cells to identify and discriminate between proteins that belong to the host and those that belong to foreign organisms. There are a number of different C-type lectin subfamilies, including collectins, selectins, proteoglycans, and lymphocyte lectins.

Full Name
C-type lectin domain family 4, member a3
References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • info info
    添加购物车成功! 添加购物车失败!