Quick Order

Rat CLEC4A3 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Rat CLEC4A3 cDNA Clone Product Information
    NCBI RefSeq:NM_001005891.1
    RefSeq ORF Size:714bp
    cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member A3.
    Gene Synonym:Dcir3, Clec4a3
    Species:Rat
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with CLEC4A3 qPCR primers for gene expression analysis, RP300358 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    Background

    CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.

    The C-type lectin has a three-dimensional fold, the CRD, in which calcium ions contribute to the lectin's ability to recognize and bind carbohydrates. In the immune system, carbohydrate recognition contributes to the ability of immune cells to move from one area of the body to another. It also allows immune cells to identify and discriminate between proteins that belong to the host and those that belong to foreign organisms. There are a number of different C-type lectin subfamilies, including collectins, selectins, proteoglycans, and lymphocyte lectins.

    References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • Size / Price
    Catalog: RG80392-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"