After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CLEC4A3 Gene ORF cDNA clone expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat CLEC4A3 cDNA Clone Product Information
NCBI RefSeq:NM_001005891.1
RefSeq ORF Size:714bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member A3 with N terminal Flag tag.
Gene Synonym:Dcir3, Clec4a3
Species:Rat
Vector:pCMV3-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.

The C-type lectin has a three-dimensional fold, the CRD, in which calcium ions contribute to the lectin's ability to recognize and bind carbohydrates. In the immune system, carbohydrate recognition contributes to the ability of immune cells to move from one area of the body to another. It also allows immune cells to identify and discriminate between proteins that belong to the host and those that belong to foreign organisms. There are a number of different C-type lectin subfamilies, including collectins, selectins, proteoglycans, and lymphocyte lectins.

References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • Size / Price
    Catalog: RG80392-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"