Quick Order

Text Size:AAA

Rat CLEC4A3 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Rat CLEC4A3 cDNA Clone Product Information
NCBI RefSeq:NM_001005891.1
RefSeq ORF Size:714bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 4, member A3 with C terminal HA tag.
Gene Synonym:Dcir3, Clec4a3
Species:Rat
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CLEC4A3 contains 1 C-type lectin domain and belongs to the C-type lectin-like domain-containing (CLEC) family. Lectins are proteins that are able to recognize and bind with specific carbohydrate molecules. C-type lectins are an important group of proteins found in the immune system of animals. These lectins are named C-type because of their calcium dependent carbohydrate recognition domain (CRD). In the immune system, C-type lectins act as recognition molecules by binding to foreign microorganisms. They also promote the movement and selective adhesion of white blood cells.

The C-type lectin has a three-dimensional fold, the CRD, in which calcium ions contribute to the lectin's ability to recognize and bind carbohydrates. In the immune system, carbohydrate recognition contributes to the ability of immune cells to move from one area of the body to another. It also allows immune cells to identify and discriminate between proteins that belong to the host and those that belong to foreign organisms. There are a number of different C-type lectin subfamilies, including collectins, selectins, proteoglycans, and lymphocyte lectins.

References
  • Gibbs RA, et al. (2004) Genome sequence of the Brown Norway rat yields insights into mammalian evolution. Nature. 428:493-521.
  • Carninci P, et al. (1999) High-efficiency full-length cDNA cloning. Methods Enzymol. 303:19-44.
  • Shibata K, et al. (2000) RIKEN integrated sequence analysis (RISA) system--384-format sequencing pipeline with 384 multicapillary sequencer. Genome Res. 10:1757-71.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"