Quick Order

Rat CLEC14A ORF mammalian expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
Rat CLEC14A cDNA Clone Product Information
NCBI RefSeq:NM_001014077.1
RefSeq ORF Size:1407bp
cDNA Description:Full length Clone DNA of Rattus norvegicus C-type lectin domain family 14, member A with N terminal Flag tag.
Gene Synonym:RGD1306232, Clec14a
Species:Rat
Vector:pCMV3-SP-N-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

C-type lectin domain family 14 member A, also known as Epidermal growth factor receptor 5 and CLEC14A, is a member of the C-type lectin domain (CTLD) family that contains one c-type lectin domain and one EGF-like domain. Mouse CLEC14A is a 459 amino acid single-pass type I membrane protein. The superfamily of proteins containing C-type lectin-like domains (CTLDs) is a large group of extracellular Metazoan proteins with diverse functions. The CTLD structure has a characteristic double-loop ('loop-in-a-loop') stabilized by two highly conserved disulfide bridges located at the bases of the loops, as well as a set of conserved hydrophobic and polar interactions. Members of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily share a common fold and are involved in a variety of functions, such as generalized defense mechanisms against foreign agents, discrimination between healthy and pathogen-infected cells, and endocytosis and blood coagulation. Genome-level studies on human, elegans and melanogaster demonstrated almost complete divergence among invertebrate and mammalian families of CTLD-containing proteins (CTLDcps). The vertebrate CTLDcp families were essentially formed early in vertebrate evolution and are completely different from the invertebrate families. The composition of the CTLDcp superfamily in fish and mammals suggests that large scale duplication events played an important role in the evolution of vertebrates.

References
  • Ebner S, et al. (2003) Evolutionary analysis reveals collective properties and specificity in the C-type lectin and lectin-like domain superfamily. Proteins. 53(1): 44-55.
  • Zelensky AN, et al. (2005) The C-type lectin-like domain superfamily. Gready JE. FEBS J. 272(24): 6179-217.
  • Size / Price
    Catalog: RG80211-NF
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"