Claudin18 cDNA ORF Clone, Rat, untagged

Cat: RG81063-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Claudin18 Reagents
CRO Services
Product recommended

All Claudin18 Reagents
Claudin18 cDNA ORF Clone, Rat, untagged General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
786 bp
Description
Full length Clone DNA of Rat claudin 18.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Claudin18 Background Information
Full Name
claudin 18

Claudin18 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Claudin18 cDNA ORF Clone in Cloning Vector, Rat RG81063-U
Claudin18 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81063-ACGLN
Claudin18 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81063-ACG
Claudin18 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81063-ACR
Claudin18 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81063-CF
Claudin18 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81063-NF
Claudin18 cDNA ORF Clone, Rat, C-His tag RG81063-CH
Claudin18 cDNA ORF Clone, Rat, N-His tag RG81063-NH
Claudin18 cDNA ORF Clone, Rat, C-HA tag RG81063-CY
Claudin18 cDNA ORF Clone, Rat, N-HA tag RG81063-NY
Claudin18 cDNA ORF Clone, Rat, C-Myc tag RG81063-CM
Claudin18 cDNA ORF Clone, Rat, N-Myc tag RG81063-NM
Claudin18 qPCR Primer Pairs, Rat RP301027

Claudin18 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Claudin18 cDNA ORF Clone in Cloning Vector, Human HG20047-U
Claudin18 cDNA ORF Clone, Human, untagged HG20047-UT
Claudin18 cDNA ORF Clone, Human, C-GFPSpark® tag HG20047-ACG
Claudin18 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG20047-ACGLN
Claudin18 cDNA ORF Clone, Human, C-OFPSpark® tag HG20047-ACR
Claudin18 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG20047-CF
Claudin18 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG20047-NF
Claudin18 cDNA ORF Clone, Human, C-His tag HG20047-CH
Claudin18 cDNA ORF Clone, Human, N-His tag HG20047-NH
Claudin18 cDNA ORF Clone, Human, C-HA tag HG20047-CY
Claudin18 cDNA ORF Clone, Human, N-HA tag HG20047-NY
Claudin18 cDNA ORF Clone, Human, C-Myc tag HG20047-CM
Claudin18 cDNA ORF Clone, Human, N-Myc tag HG20047-NM
info info
添加购物车成功! 添加购物车失败!