Claudin-11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag

Cat: RG81317-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Claudin-11 Reagents
CRO Services
Product recommended

All Claudin-11 Reagents
Claudin-11 cDNA ORF Clone, Rat, C-DDK (Flag®) tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
624 bp
Description
Full length Clone DNA of Rat claudin 11 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Claudin-11 Background Information

Claudin-11, also known as CLDN11, belongs to the group of claudins. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands function as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions.Claudin-11 is a tight junction associated protein and is a major component of central nervous system (CNS) myelin that is necessary for normal CNS function. Human blood-testis barrier disruption is related to a dysfunction of CLDN11 gene. It plays an important role in regulating proliferation and migration of oligodendrocytes.

Full Name
claudin 11
References
  • Tsukita S, et al. (2001) Multifunctional strands in tight junctions. Nat Rev Mol Cell Biol. 2(4): 285-3.
  • Heiskala M, et al. (2001) The roles of claudin superfamily proteins in paracellular transport. Traffic 2. (2):93-8.
  • Bronstein JM, et al. (2000) Involvement of OSP/claudin-11 in oligodendrocyte membrane interactions: role in biology and disease. J Neurosci Res. 59(6):706-11.
  • Claudin-11 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Claudin-11 cDNA ORF Clone in Cloning Vector, Rat RG81317-G
    Claudin-11 cDNA ORF Clone, Rat, untagged RG81317-UT
    Claudin-11 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81317-ACG
    Claudin-11 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81317-ACGLN
    Claudin-11 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81317-ACR
    Claudin-11 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81317-NF
    Claudin-11 cDNA ORF Clone, Rat, C-His tag RG81317-CH
    Claudin-11 cDNA ORF Clone, Rat, N-His tag RG81317-NH
    Claudin-11 cDNA ORF Clone, Rat, C-HA tag RG81317-CY
    Claudin-11 cDNA ORF Clone, Rat, N-HA tag RG81317-NY
    Claudin-11 cDNA ORF Clone, Rat, C-Myc tag RG81317-CM
    Claudin-11 cDNA ORF Clone, Rat, N-Myc tag RG81317-NM
    Claudin-11 qPCR Primer Pairs, Rat RP301288

    Claudin-11 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Claudin-11 cDNA ORF Clone in Cloning Vector, Mouse MG51441-G
    Claudin-11 cDNA ORF Clone, Mouse, untagged MG51441-UT
    Claudin-11 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51441-ACG
    Claudin-11 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51441-ACGLN
    Claudin-11 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51441-ANG
    Claudin-11 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51441-ACR
    Claudin-11 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51441-ANR
    Claudin-11 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51441-CF
    Claudin-11 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51441-NF
    Claudin-11 cDNA ORF Clone, Mouse, C-His tag MG51441-CH
    Claudin-11 cDNA ORF Clone, Mouse, N-His tag MG51441-NH
    Claudin-11 cDNA ORF Clone, Mouse, C-HA tag MG51441-CY
    Claudin-11 cDNA ORF Clone, Mouse, N-HA tag MG51441-NY
    Claudin-11 cDNA ORF Clone, Mouse, C-Myc tag MG51441-CM
    Claudin-11 cDNA ORF Clone, Mouse, N-Myc tag MG51441-NM
    Claudin-11 qPCR Primer Pairs, Mouse MP201325
    info info
    添加购物车成功! 添加购物车失败!