CHODL cDNA ORF Clone, Rat, C-HA tag

Cat: RG80396-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All CHODL Reagents
CRO Services
Product recommended

All CHODL Reagents
CHODL cDNA ORF Clone, Rat, C-HA tag General Information
Gene
Species
Rat
NCBI Ref Seq
RefSeq ORF Size
957 bp
Description
Full length Clone DNA of Rat chondrolectin with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

CHODL Background Information
Full Name
chondrolectin
References
  • Weng L, et al. (2003) A novel alternative spliced chondrolectin isoform lacking the transmembrane domain is expressed during T cell maturation. J Biol Chem. 278(21): 19164-70.
  • Masuda K, et al. (2011) Chondrolectin is a novel diagnostic biomarker and a therapeutic target for lung cancer. Clin Cancer Res. 17(24): 7712-22.
  • Weng L, et al. (2002) Molecular cloning and characterization of human chondrolectin, a novel type I transmembrane protein homologous to C-type lectins. Genomics. 80(1): 62-70.
  • CHODL cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    CHODL cDNA ORF Clone in Cloning Vector, Rat RG80396-G
    CHODL cDNA ORF Clone, Rat, untagged RG80396-UT
    CHODL cDNA ORF Clone, Rat, C-GFPSpark® tag RG80396-ACG
    CHODL Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80396-ACGLN
    CHODL cDNA ORF Clone, Rat, C-OFPSpark® tag RG80396-ACR
    CHODL cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80396-CF
    CHODL cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80396-NF
    CHODL cDNA ORF Clone, Rat, C-His tag RG80396-CH
    CHODL cDNA ORF Clone, Rat, N-His tag RG80396-NH
    CHODL cDNA ORF Clone, Rat, N-HA tag RG80396-NY
    CHODL cDNA ORF Clone, Rat, C-Myc tag RG80396-CM
    CHODL cDNA ORF Clone, Rat, N-Myc tag RG80396-NM
    CHODL qPCR Primer Pairs, Rat RP300362

    CHODL cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    CHODL cDNA ORF Clone in Cloning Vector, Mouse MG50699-M
    CHODL cDNA ORF Clone, Mouse, untagged MG50699-UT
    CHODL cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50699-ACG
    CHODL Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50699-ACGLN
    CHODL cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50699-ACR
    CHODL cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50699-CF
    CHODL cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50699-NF
    CHODL cDNA ORF Clone, Mouse, C-His tag MG50699-CH
    CHODL cDNA ORF Clone, Mouse, N-His tag MG50699-NH
    CHODL cDNA ORF Clone, Mouse, C-HA tag MG50699-CY
    CHODL cDNA ORF Clone, Mouse, N-HA tag MG50699-NY
    CHODL cDNA ORF Clone, Mouse, C-Myc tag MG50699-CM
    CHODL cDNA ORF Clone, Mouse, N-Myc tag MG50699-NM
    CHODL qPCR Primer Pairs, Mouse MP200674
    info info
    添加购物车成功! 添加购物车失败!